sfpq

Ensembl ID:
ENSDARG00000011564
ZFIN ID:
ZDB-GENE-040426-2452
Description:
splicing factor, proline- and glutamine-rich [Source:RefSeq peptide;Acc:NP_998443]
Human Orthologue:
SFPQ
Human Description:
splicing factor proline/glutamine-rich [Source:HGNC Symbol;Acc:10774]
Mouse Orthologue:
Sfpq
Mouse Description:
splicing factor proline/glutamine rich (polypyrimidine tract binding protein associated) Gene [Sourc

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29250 Nonsense Mutation detected in F1 DNA During 2017
sa667 Nonsense F2 line generated During 2017
sa36893 Nonsense Mutation detected in F1 DNA During 2017
sa17716 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa29250
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017359 Nonsense 197 638 1 10

The following transcripts of ENSDARG00000011564 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 40987092)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 40439630
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCCTTGAAGCAAGAGCAGACGCCAGCACCAACACCCCCACCAGCACAA[C/T]AACAGCAGCAACAGCAACAACAACAAAAACAGACTCCCGCAAACGAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa667
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017359 Nonsense 407 638 4 10

The following transcripts of ENSDARG00000011564 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 40988392)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 40440930
KASP Assay ID:
554-0575.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTGTTGGAGCAGTATGATGACGAGGACGGTTTGCCCGAGAAGCTTGCA[C/T]AGAAAAACCCCAGTTATCAAAAGTAGGTTCCAAATGTTTGATCACATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36893
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017359 Nonsense 529 638 7 10

The following transcripts of ENSDARG00000011564 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 40991501)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 40444039
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACGTCGTAGGAGAGAGGAGGAGATGATGCGGCAGAGGGAAATCGAAGAA[C/T]AATTGAGGCGCAAACGCGAGGAATCTTACAGAATGAACAACTTCATGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17716
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017359 Essential Splice Site 599 638 9 10

The following transcripts of ENSDARG00000011564 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 40993668)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 40446206
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAGGGACTAAGTGGATCAACACAAGGGGGCCTAGCGTCCAACGAAATG[G/A]TAATGTTTTCATGAGTTKAAAGCATGAGTGAATGTGAGCNNGTGTGTGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link