arrb2b

Ensembl ID:
ENSDARG00000011545
ZFIN ID:
ZDB-GENE-040426-1332
Description:
arrestin, beta 2b [Source:RefSeq peptide;Acc:NP_957418]
Human Orthologue:
ARRB2
Human Description:
arrestin, beta 2 [Source:HGNC Symbol;Acc:712]
Mouse Orthologue:
Arrb2
Mouse Description:
arrestin, beta 2 Gene [Source:MGI Symbol;Acc:MGI:99474]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5416 Essential Splice Site Mutation detected in F1 DNA During 2016
sa40890 Nonsense Mutation detected in F1 DNA During 2016
sa38610 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa5416
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026295 Essential Splice Site 119 408 5 15
ENSDART00000146323 Essential Splice Site 131 173 4 6
Genomic Location:
Chromosome 7 (position 27105401)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGACTGCTGAAGAAGCTTGGYCAGAAYGCATATCCCTTCAACTTCACKG[T/C]GACCCTTCATTTACTCATTTACTCAAAGTRTACTTCAGTTAGGTTAGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40890
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026295 Nonsense 231 408 9 15
ENSDART00000146323   None 173 None 6
Genomic Location:
Chromosome 7 (position 27114259)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATCAGCGTCAATGTCCATGTCACCAACAACTCCACCAAAACAGTTAAA[C/T]GAGTTAAAATCTCAGGTAAGGAGAGCATTTTAATAATTGATGTTGCATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38610
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026295 Nonsense 252 408 10 15
ENSDART00000146323   None 173 None 6
Genomic Location:
Chromosome 7 (position 27115502)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCGACAGTATGCCGATATCTGTTTATTCAGCACCGCTCAGTACAAATG[T/A]CCTGTGGCTCAGGTAGAAGCCGAGTGAGTAGCTCTCTGTCCCTCTTTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link