arrb2b

Ensembl ID:
ENSDARG00000011545
ZFIN ID:
ZDB-GENE-040426-1332
Description:
arrestin, beta 2b [Source:RefSeq peptide;Acc:NP_957418]
Human Orthologue:
ARRB2
Human Description:
arrestin, beta 2 [Source:HGNC Symbol;Acc:712]
Mouse Orthologue:
Arrb2
Mouse Description:
arrestin, beta 2 Gene [Source:MGI Symbol;Acc:MGI:99474]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5416 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5416
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026295 Essential Splice Site 119 408 5 15
ENSDART00000146323 Essential Splice Site 131 173 4 6
Genomic Location:
Chromosome 7 (position 27105401)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGACTGCTGAAGAAGCTTGGYCAGAAYGCATATCCCTTCAACTTCACKG[T/C]GACCCTTCATTTACTCATTTACTCAAAGTRTACTTCAGTTAGGTTAGCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/y7f6l0zm