arrb2b

Ensembl ID:
ENSDARG00000011545
ZFIN ID:
ZDB-GENE-040426-1332
Description:
arrestin, beta 2b [Source:RefSeq peptide;Acc:NP_957418]
Human Orthologue:
ARRB2
Human Description:
arrestin, beta 2 [Source:HGNC Symbol;Acc:712]
Mouse Orthologue:
Arrb2
Mouse Description:
arrestin, beta 2 Gene [Source:MGI Symbol;Acc:MGI:99474]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40890 Nonsense Mutation detected in F1 DNA During 2016
sa38610 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa40890
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026295 Nonsense 231 408 9 15
ENSDART00000146323   None 173 None 6
Genomic Location (Zv9):
Chromosome 7 (position 27114259)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 25717198
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATCAGCGTCAATGTCCATGTCACCAACAACTCCACCAAAACAGTTAAA[C/T]GAGTTAAAATCTCAGGTAAGGAGAGCATTTTAATAATTGATGTTGCATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38610
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026295 Nonsense 252 408 10 15
ENSDART00000146323   None 173 None 6
Genomic Location (Zv9):
Chromosome 7 (position 27115502)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 25718441
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCGACAGTATGCCGATATCTGTTTATTCAGCACCGCTCAGTACAAATG[T/A]CCTGTGGCTCAGGTAGAAGCCGAGTGAGTAGCTCTCTGTCCCTCTTTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link