hspb7

Ensembl ID:
ENSDARG00000011538
ZFIN ID:
ZDB-GENE-041010-136
Description:
heat shock protein family, alpha-crystallin-related, b7 [Source:RefSeq peptide;Acc:NP_001006040]
Human Orthologue:
HSPB7
Human Description:
heat shock 27kDa protein family, member 7 (cardiovascular) [Source:HGNC Symbol;Acc:5249]
Mouse Orthologue:
Hspb7
Mouse Description:
heat shock protein family, member 7 (cardiovascular) Gene [Source:MGI Symbol;Acc:MGI:1352494]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24327 Nonsense Available for shipment Available now
sa30739 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24327
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023984 Nonsense 10 161 1 3
Genomic Location (Zv9):
Chromosome 23 (position 24550293)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24336769
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGAGAAAGCATCTCAACACTAATGAGCGCGAGCAATTCTTCTGCCTAT[C/T]GATCGGAGCGTAGTTACCATCAGACGTCATCCTCCTCATCTTCATCCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30739
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023984 Essential Splice Site 102 161 2 3
Genomic Location (Zv9):
Chromosome 23 (position 24546011)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24332487
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGATCGTCACCACCTCAAACAATCAGATTGAAGTTCATGCTGAAAAG[G/A]TAAACACAAACATCTGCACAACATAACTGTGAATTGTTTTATATAATTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link