sema6dl

Ensembl ID:
ENSDARG00000011533
ZFIN ID:
ZDB-GENE-050417-171
Description:
semaphorin-6D [Source:RefSeq peptide;Acc:NP_001017682]
Human Orthologue:
SEMA6D
Human Description:
sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D [Source:HGNC Symbol;
Mouse Orthologue:
Sema6d
Mouse Description:
sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D Gene [Source:MGI Sym

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43158 Nonsense Mutation detected in F1 DNA During 2017
sa8429 Missense, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43158
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049171 Nonsense 219 999 8 17
ENSDART00000098788 Nonsense 219 1072 7 18
ENSDART00000098791 Nonsense 219 1018 8 18
ENSDART00000123661 Nonsense 219 999 7 16
ENSDART00000130847 Nonsense 219 1018 7 17
ENSDART00000136588   None 68 None 3
Genomic Location (Zv9):
Chromosome 18 (position 38672310)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40385027
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTATGGGAGATGGTTCTGCCCTTCGCACTATCAAGTATGACTCCAAGTG[G/A]TTGAAAGGTACTTAAACTTTTGCTTGTGTGCTTTATTTAATTACTAGTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8429
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049171 Nonsense 569 999 16 17
ENSDART00000098788 Nonsense 571 1072 15 18
ENSDART00000098791 Nonsense 569 1018 16 18
ENSDART00000123661 Nonsense 569 999 15 16
ENSDART00000130847 Nonsense 569 1018 15 17
ENSDART00000136588 Missense 12 68 1 3
Genomic Location (Zv9):
Chromosome 18 (position 38678226)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40390943
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTATGAGCAAGATGTTGAATATGGCAACACTGCTCMCCTCGGGGATTG[T/A]CACGGTAAGCTTATTAACACGWATCTCTTTTCAAAAACATAAGTTAGTAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Eating disorders: Genome-wide association analysis of eating disorder-related symptoms, behaviors, and personality traits. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link