upb1

Ensembl ID:
ENSDARG00000011521
ZFIN ID:
ZDB-GENE-030131-1380
Description:
beta-ureidopropionase [Source:RefSeq peptide;Acc:NP_955910]
Human Orthologue:
UPB1
Human Description:
ureidopropionase, beta [Source:HGNC Symbol;Acc:16297]
Mouse Orthologue:
Upb1
Mouse Description:
ureidopropionase, beta Gene [Source:MGI Symbol;Acc:MGI:2143535]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16230 Essential Splice Site, Missense Available for shipment Available now

Mutation Details

Allele Name:
sa16230
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005345 Essential Splice Site 207 384 None 10
ENSDART00000133989 Missense 79 280 2 7
Genomic Location:
Chromosome 8 (position 31563920)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCAAAACACGGAAGAATCACATTCCCCGAGTTGGAGATTTTAATGAAG[T/G]CAGTCAAACTACCTTCAGTGAGNAAACAACACAGACTYACCAACACTCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n495ltae