upb1

Ensembl ID:
ENSDARG00000011521
ZFIN ID:
ZDB-GENE-030131-1380
Description:
beta-ureidopropionase [Source:RefSeq peptide;Acc:NP_955910]
Human Orthologue:
UPB1
Human Description:
ureidopropionase, beta [Source:HGNC Symbol;Acc:16297]
Mouse Orthologue:
Upb1
Mouse Description:
ureidopropionase, beta Gene [Source:MGI Symbol;Acc:MGI:2143535]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16230 Essential Splice Site, Missense Available for shipment Available now
sa41240 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa16230
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005345 Essential Splice Site 207 384 None 10
ENSDART00000133989 Missense 79 280 2 7
Genomic Location (Zv9):
Chromosome 8 (position 31563920)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30706646
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCAAAACACGGAAGAATCACATTCCCCGAGTTGGAGATTTTAATGAAG[T/G]CAGTCAAACTACCTTCAGTGAGNAAACAACACAGACTYACCAACACTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41240
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005345 Nonsense 211 384 6 10
ENSDART00000133989 Nonsense 115 280 3 7
Genomic Location (Zv9):
Chromosome 8 (position 31569627)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30712353
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTTATGGTGGTGTTTTTTTTTTTACTCTGCCTCCAGTCGACGTATTA[T/A]ATGGAAGGCAACACTGGTCATCGTGTCTTCCAAACACAGTTTGGAAAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link