mif4gda

Ensembl ID:
ENSDARG00000011511
ZFIN ID:
ZDB-GENE-040426-1382
Description:
MIF4G domain-containing protein A [Source:UniProtKB/Swiss-Prot;Acc:B0UXU6]
Human Orthologue:
MIF4GD
Human Description:
MIF4G domain containing [Source:HGNC Symbol;Acc:24030]
Mouse Orthologue:
Mif4gd
Mouse Description:
MIF4G domain containing Gene [Source:MGI Symbol;Acc:MGI:1916924]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33839 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33839
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025295 Nonsense 29 216 3 6
ENSDART00000131945 Nonsense 29 216 3 6
Genomic Location (Zv9):
Chromosome 6 (position 18659898)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 22868652
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTATTGTATTTTACACCCCTTCCTCACAGATCCCAAGACAGTAGATTTG[G/T]AGAAGCTGTCTAATGCTGTCGTAGAACATTCTTTGAAAGACCTGTCATTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link