rcc2

Ensembl ID:
ENSDARG00000011510
ZFIN ID:
ZDB-GENE-040426-2213
Description:
Protein RCC2 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6NYE2]
Human Orthologue:
RCC2
Human Description:
regulator of chromosome condensation 2 [Source:HGNC Symbol;Acc:30297]
Mouse Orthologue:
Rcc2
Mouse Description:
regulator of chromosome condensation 2 Gene [Source:MGI Symbol;Acc:MGI:1919784]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43969 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43969
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010647 Nonsense 490 495 13 13
ENSDART00000134587   None 233 None 7
ENSDART00000139092   None 226 None 7
Genomic Location (Zv9):
Chromosome 23 (position 21816911)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21596218
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGCAAGACACAGAGCAAGAGAAGGAGAAGCTGAAGAAGCTGCCTGAATA[C/A]AATCCACGCACTCTCTGATGTGACCCCGCTCATTTCCTCCAGGGGCTTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Basal cell carcinoma : Common variants on 1p36 and 1q42 are associated with cutaneous basal cell carcinoma but not with melanoma or pigmentation traits. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link