si:ch211-212o1.2

Ensembl ID:
ENSDARG00000011498
ZFIN ID:
ZDB-GENE-041111-310
Description:
hypothetical protein LOC492735 [Source:RefSeq peptide;Acc:NP_001073633]
Mouse Orthologue:
Tmem189
Mouse Description:
transmembrane protein 189 Gene [Source:MGI Symbol;Acc:MGI:2142624]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32200 Nonsense Available for shipment Available now
sa23279 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32200
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005027 Nonsense 238 288 6 7
ENSDART00000146898   None 144 None 5
ENSDART00000147797 Nonsense 233 283 5 6
Genomic Location (Zv9):
Chromosome 18 (position 17707980)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 18059746
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACTGCCACCTAGTGCTGCCCCGCAAGCACCACCGGATCCATCATGTGT[C/A]GCCGCATGAGACTTACTACTGCATCACTACAGGTACACTACTGATAGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23279
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005027 Nonsense 251 288 7 7
ENSDART00000146898   None 144 None 5
ENSDART00000147797 Nonsense 246 283 6 6
Genomic Location (Zv9):
Chromosome 18 (position 17718316)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 18070082
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATGACACCTCTGCGTCTCTGTCTCCATCCTTCTCTCCCTCAGGCTGGT[T/A]GAACTATCCGCTGGACAGAGTGGGCTTTTGGCGGACAATGGAGTGGCTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link