ppm1bb

Ensembl ID:
ENSDARG00000011496
ZFIN ID:
ZDB-GENE-041114-185
Description:
protein phosphatase 1A, magnesium dependent, alpha [Source:RefSeq peptide;Acc:NP_001007314]
Human Orthologue:
PPM1B
Human Description:
protein phosphatase, Mg2+/Mn2+ dependent, 1B [Source:HGNC Symbol;Acc:9276]
Mouse Orthologue:
Ppm1b
Mouse Description:
protein phosphatase 1B, magnesium dependent, beta isoform Gene [Source:MGI Symbol;Acc:MGI:101841]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42036 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42036
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011662 Essential Splice Site None 382 2 6
Genomic Location (Zv9):
Chromosome 12 (position 26995211)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 25376199
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACACACACGCTACGTTTTGTCAGATAAAGCAATTGCTCTTTTTCTTGCA[G/A]ACGGTGTCCTGAGCCATGGGGGCCTTCTTGGACAAACCGAAAACGGAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link