SCUBE3
- Ensembl ID:
- ENSDARG00000011490
- Description:
- signal peptide, CUB domain, EGF-like 3 [Source:HGNC Symbol;Acc:13655]
- Human Orthologue:
- SCUBE3
- Human Description:
- signal peptide, CUB domain, EGF-like 3 [Source:HGNC Symbol;Acc:13655]
- Mouse Orthologue:
- Scube3
- Mouse Description:
- signal peptide, CUB domain, EGF-like 3 Gene [Source:MGI Symbol;Acc:MGI:3045253]
Alleles
There are 9 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa31095 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa44045 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa31094 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa44044 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa37783 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa39426 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa44043 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa37782 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa10452 |
Essential Splice Site |
Available for shipment |
Available now |
Mutation Details
- Allele Name:
- sa31095
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 23 (position 41702042)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
23 |
41536257 |
GRCz11 |
23 |
41431750 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAATGCAGACCAGGATTTCAGCTCACCAAGAACAATCGAGACTGTAAATG[T/G]GAGTAATCAATCATGTTAATTACACACTCTCCACAATGGCGAGGAAAGAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44045
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 23 (position 41702042)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
23 |
41536257 |
GRCz11 |
23 |
41431750 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAATGCAGACCAGGATTTCAGCTCACCAAGAACAATCGAGACTGTAAATG[T/G]GAGTAATCAATCATGTTAATTACACACTCTCCACAATGGCGAGGAAAGAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31094
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 23 (position 41702042)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
23 |
41536257 |
GRCz11 |
23 |
41431750 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAATGCAGACCAGGATTTCAGCTCACCAAGAACAATCGAGACTGTAAATG[T/G]GAGTAATCAATCATGTTAATTACACACTCTCCACAATGGCGAGGAAAGAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44044
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000102879 |
Nonsense |
62 |
829 |
2 |
19 |
- Genomic Location (Zv9):
- Chromosome 23 (position 41700184)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
23 |
41534399 |
GRCz11 |
23 |
41429892 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGCGGCTGTCAGCACATCTGTGAGGAAACGGATCATGGGCCCAAATGCT[C/A]GTGTCACATGAAGTTTGCTCTTCACTCAGATGGAAAGACCTGTGTAGGTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37783
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000102879 |
Nonsense |
123 |
829 |
4 |
19 |
- Genomic Location (Zv9):
- Chromosome 23 (position 41651348)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
23 |
41485563 |
GRCz11 |
23 |
41381056 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTTTGCTCAGTCTCTCTCTCTCTCTCTCTGATTACAGACATTGATGAATG[T/A]CGCATGAACAACGGTGGCTGTGATCACGTTTGCAGAAACACCGTCGGCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39426
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000102879 |
Essential Splice Site |
404 |
829 |
11 |
19 |
- Genomic Location (Zv9):
- Chromosome 23 (position 41608575)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
23 |
41441290 |
GRCz11 |
23 |
41333254 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAGGAAACGCGCTGTGTGAAAGTTCTGGCGTTCATCTATTTTTCATGTTC[A/T]GGGAACTGCAACATGATGTGTCAACGGCAGCACATGGAGCAGCAGATGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44043
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000102879 |
Nonsense |
410 |
829 |
11 |
19 |
- Genomic Location (Zv9):
- Chromosome 23 (position 41608554)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
23 |
41441269 |
GRCz11 |
23 |
41333233 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTTCTGGCGTTCATCTATTTTTCATGTTCAGGGAACTGCAACATGATGTG[T/A]CAACGGCAGCACATGGAGCAGCAGATGAAGACGTACATTAAAACCCTGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37782
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000102879 |
Essential Splice Site |
586 |
829 |
15 |
19 |
- Genomic Location (Zv9):
- Chromosome 23 (position 41596368)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
23 |
41429083 |
GRCz11 |
23 |
41321047 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTAGACTACTGTCTATGTGTGTGTGTGTGTGTGTGTATAGTGTTGTGTTC[T/A]CCAGGTCATTATTATAACACATCAGTTCATCGGTGTATCCGCTGTCCTCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10452
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000102879 |
Essential Splice Site |
701 |
829 |
16 |
19 |
- Genomic Location (Zv9):
- Chromosome 23 (position 41595489)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
23 |
41428204 |
GRCz11 |
23 |
41320168 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CCTCCCGTCTGAGGATGAGTGTGGAGATGTGCTGGTCATGAGGAARAACT[G/T]TACGTCTTTCTGTTTTTCCACAGTTTASCATTATCRACCTCCACYTTTAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: