SCUBE3

Ensembl ID:
ENSDARG00000011490
Description:
signal peptide, CUB domain, EGF-like 3 [Source:HGNC Symbol;Acc:13655]
Human Orthologue:
SCUBE3
Human Description:
signal peptide, CUB domain, EGF-like 3 [Source:HGNC Symbol;Acc:13655]
Mouse Orthologue:
Scube3
Mouse Description:
signal peptide, CUB domain, EGF-like 3 Gene [Source:MGI Symbol;Acc:MGI:3045253]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31095 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44045 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31094 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44044 Nonsense Mutation detected in F1 DNA During 2017
sa37783 Nonsense Mutation detected in F1 DNA During 2017
sa39426 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44043 Nonsense Mutation detected in F1 DNA During 2017
sa37782 Essential Splice Site Mutation detected in F1 DNA During 2017
sa10452 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31095
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102879 Essential Splice Site 39 829 1 19
ENSDART00000102879 Essential Splice Site 39 829 1 19
ENSDART00000102879 Essential Splice Site 39 829 1 19
Genomic Location (Zv9):
Chromosome 23 (position 41702042)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 41536257
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATGCAGACCAGGATTTCAGCTCACCAAGAACAATCGAGACTGTAAATG[T/G]GAGTAATCAATCATGTTAATTACACACTCTCCACAATGGCGAGGAAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44045
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102879 Essential Splice Site 39 829 1 19
ENSDART00000102879 Essential Splice Site 39 829 1 19
ENSDART00000102879 Essential Splice Site 39 829 1 19
Genomic Location (Zv9):
Chromosome 23 (position 41702042)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 41536257
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATGCAGACCAGGATTTCAGCTCACCAAGAACAATCGAGACTGTAAATG[T/G]GAGTAATCAATCATGTTAATTACACACTCTCCACAATGGCGAGGAAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31094
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102879 Essential Splice Site 39 829 1 19
ENSDART00000102879 Essential Splice Site 39 829 1 19
ENSDART00000102879 Essential Splice Site 39 829 1 19
Genomic Location (Zv9):
Chromosome 23 (position 41702042)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 41536257
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATGCAGACCAGGATTTCAGCTCACCAAGAACAATCGAGACTGTAAATG[T/G]GAGTAATCAATCATGTTAATTACACACTCTCCACAATGGCGAGGAAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44044
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102879 Nonsense 62 829 2 19
Genomic Location (Zv9):
Chromosome 23 (position 41700184)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 41534399
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCGGCTGTCAGCACATCTGTGAGGAAACGGATCATGGGCCCAAATGCT[C/A]GTGTCACATGAAGTTTGCTCTTCACTCAGATGGAAAGACCTGTGTAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37783
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102879 Nonsense 123 829 4 19
Genomic Location (Zv9):
Chromosome 23 (position 41651348)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 41485563
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTGCTCAGTCTCTCTCTCTCTCTCTCTGATTACAGACATTGATGAATG[T/A]CGCATGAACAACGGTGGCTGTGATCACGTTTGCAGAAACACCGTCGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39426
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102879 Essential Splice Site 404 829 11 19
Genomic Location (Zv9):
Chromosome 23 (position 41608575)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 41441290
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGGAAACGCGCTGTGTGAAAGTTCTGGCGTTCATCTATTTTTCATGTTC[A/T]GGGAACTGCAACATGATGTGTCAACGGCAGCACATGGAGCAGCAGATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44043
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102879 Nonsense 410 829 11 19
Genomic Location (Zv9):
Chromosome 23 (position 41608554)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 41441269
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCTGGCGTTCATCTATTTTTCATGTTCAGGGAACTGCAACATGATGTG[T/A]CAACGGCAGCACATGGAGCAGCAGATGAAGACGTACATTAAAACCCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37782
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102879 Essential Splice Site 586 829 15 19
Genomic Location (Zv9):
Chromosome 23 (position 41596368)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 41429083
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAGACTACTGTCTATGTGTGTGTGTGTGTGTGTGTATAGTGTTGTGTTC[T/A]CCAGGTCATTATTATAACACATCAGTTCATCGGTGTATCCGCTGTCCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10452
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102879 Essential Splice Site 701 829 16 19
Genomic Location (Zv9):
Chromosome 23 (position 41595489)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 41428204
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCCCGTCTGAGGATGAGTGTGGAGATGTGCTGGTCATGAGGAARAACT[G/T]TACGTCTTTCTGTTTTTCCACAGTTTASCATTATCRACCTCCACYTTTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link