ENSDARG00000011490 - Zebrafish Mutation Project

Search Zebrafish Mutation Project

e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457

You can look for mutant lines by browsing a complete list or by searching for a particular gene

SCUBE3

Ensembl ID:: ENSDARG00000011490
Description:: signal peptide, CUB domain, EGF-like 3 [Source:HGNC Symbol;Acc:13655]
Human Orthologue:: SCUBE3
Human Description:: signal peptide, CUB domain, EGF-like 3 [Source:HGNC Symbol;Acc:13655]
Mouse Orthologue:: Scube3
Mouse Description:: signal peptide, CUB domain, EGF-like 3 Gene [Source:MGI Symbol;Acc:MGI:3045253]

Alleles

There are 9 alleles of this gene:

Allele name	Consequence	Status	Availability Estimate
sa31095	Essential Splice Site	Mutation detected in F1 DNA	During 2018
sa44045	Essential Splice Site	Mutation detected in F1 DNA	During 2018
sa31094	Essential Splice Site	Mutation detected in F1 DNA	During 2018
sa44044	Nonsense	Mutation detected in F1 DNA	During 2018
sa37783	Nonsense	Mutation detected in F1 DNA	During 2018
sa39426	Essential Splice Site	Mutation detected in F1 DNA	During 2018
sa44043	Nonsense	Mutation detected in F1 DNA	During 2018
sa37782	Essential Splice Site	Mutation detected in F1 DNA	During 2018
sa10452	Essential Splice Site	Available for shipment	Available now

Mutation Details

Allele Name:: sa31095
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: T > C
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000102879	Essential Splice Site	39	829	1	19
ENSDART00000102879	Essential Splice Site	39	829	1	19
ENSDART00000102879	Essential Splice Site	39	829	1	19

Genomic Location (Zv9):

Chromosome 23 (position 41702042)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	23	41536257
GRCz11	23	41431750

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

GAATGCAGACCAGGATTTCAGCTCACCAAGAACAATCGAGACTGTAAATG[T/G]GAGTAATCAATCATGTTAATTACACACTCTCCACAATGGCGAGGAAAGAT

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa44045
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: T > G
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000102879	Essential Splice Site	39	829	1	19
ENSDART00000102879	Essential Splice Site	39	829	1	19
ENSDART00000102879	Essential Splice Site	39	829	1	19

Genomic Location (Zv9):

Chromosome 23 (position 41702042)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	23	41536257
GRCz11	23	41431750

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

GAATGCAGACCAGGATTTCAGCTCACCAAGAACAATCGAGACTGTAAATG[T/G]GAGTAATCAATCATGTTAATTACACACTCTCCACAATGGCGAGGAAAGAT

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa31094
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: T > G
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000102879	Essential Splice Site	39	829	1	19
ENSDART00000102879	Essential Splice Site	39	829	1	19
ENSDART00000102879	Essential Splice Site	39	829	1	19

Genomic Location (Zv9):

Chromosome 23 (position 41702042)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	23	41536257
GRCz11	23	41431750

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

GAATGCAGACCAGGATTTCAGCTCACCAAGAACAATCGAGACTGTAAATG[T/G]GAGTAATCAATCATGTTAATTACACACTCTCCACAATGGCGAGGAAAGAT

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa44044
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: C > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000102879	Nonsense	62	829	2	19

Genomic Location (Zv9):

Chromosome 23 (position 41700184)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	23	41534399
GRCz11	23	41429892

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

TGGCGGCTGTCAGCACATCTGTGAGGAAACGGATCATGGGCCCAAATGCT[C/A]GTGTCACATGAAGTTTGCTCTTCACTCAGATGGAAAGACCTGTGTAGGTG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa37783
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000102879	Nonsense	123	829	4	19

Genomic Location (Zv9):

Chromosome 23 (position 41651348)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	23	41485563
GRCz11	23	41381056

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

GTTTGCTCAGTCTCTCTCTCTCTCTCTCTGATTACAGACATTGATGAATG[T/A]CGCATGAACAACGGTGGCTGTGATCACGTTTGCAGAAACACCGTCGGCAG

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa39426
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: A > T
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000102879	Essential Splice Site	404	829	11	19

Genomic Location (Zv9):

Chromosome 23 (position 41608575)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	23	41441290
GRCz11	23	41333254

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

TAGGAAACGCGCTGTGTGAAAGTTCTGGCGTTCATCTATTTTTCATGTTC[A/T]GGGAACTGCAACATGATGTGTCAACGGCAGCACATGGAGCAGCAGATGAA

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa44043
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000102879	Nonsense	410	829	11	19

Genomic Location (Zv9):

Chromosome 23 (position 41608554)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	23	41441269
GRCz11	23	41333233

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

GTTCTGGCGTTCATCTATTTTTCATGTTCAGGGAACTGCAACATGATGTG[T/A]CAACGGCAGCACATGGAGCAGCAGATGAAGACGTACATTAAAACCCTGAA

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa37782
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2018.
Mutation:: T > A
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000102879	Essential Splice Site	586	829	15	19

Genomic Location (Zv9):

Chromosome 23 (position 41596368)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	23	41429083
GRCz11	23	41321047

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

CTAGACTACTGTCTATGTGTGTGTGTGTGTGTGTGTATAGTGTTGTGTTC[T/A]CCAGGTCATTATTATAACACATCAGTTCATCGGTGTATCCGCTGTCCTCA

Associated Phenotype:

Not determined

Mutation Details

Allele Name:: sa10452
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Order Allele From ZIRC
Order Allele From EZRC
Mutation:: G > T
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000102879	Essential Splice Site	701	829	16	19

Genomic Location (Zv9):

Chromosome 23 (position 41595489)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	23	41428204
GRCz11	23	41320168

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

CCTCCCGTCTGAGGATGAGTGTGGAGATGTGCTGGTCATGAGGAARAACT[G/T]TACGTCTTTCTGTTTTTCCACAGTTTASCATTATCRACCTCCACYTTTAC

Associated Phenotype:

Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

OMIM

OMIM information for SCUBE3

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: