gnaq

Ensembl ID:
ENSDARG00000011487
ZFIN ID:
ZDB-GENE-081104-25
Description:
guanine nucleotide-binding protein G(q) subunit alpha [Source:RefSeq peptide;Acc:NP_001138271]
Human Orthologue:
GNAQ
Human Description:
guanine nucleotide binding protein (G protein), q polypeptide [Source:HGNC Symbol;Acc:4390]
Mouse Orthologue:
Gnaq
Mouse Description:
guanine nucleotide binding protein, alpha q polypeptide Gene [Source:MGI Symbol;Acc:MGI:95776]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40566 Nonsense Mutation detected in F1 DNA During 2016
sa17830 Nonsense Available for shipment Available now
sa40565 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa40566
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013229 Nonsense 92 359 2 7
Genomic Location (Zv9):
Chromosome 5 (position 56975576)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54928102
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACCAAGCTGGTCTACCAAAACATCTTCACGTCTTCACAGTCCATGATA[C/T]GAGCAATGGACACTCTCCAGATTCTCTATAAATATGAACACAATAAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17830
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013229 Nonsense 263 359 6 7
Genomic Location (Zv9):
Chromosome 5 (position 56968041)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54920567
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAATGGAGGAAAGCAAAGCATTGTTTAGGACGATAATAACATACCCCTG[G/A]TTTCAGAATTCATCTGTTATTCTTTTTCTGAACAAGAAAGACCTTTTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40565
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013229 Essential Splice Site 296 359 6 7
Genomic Location (Zv9):
Chromosome 5 (position 56967940)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 54920466
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGAAAATAATGTTTTCACATCTTGTAGATTACTTTCCCGAATATGATG[G/A]TAAGTTTAAAAACACAGAGTTCCATCAGATTTTAGGACAAATTAAAAACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link