gnaq

Ensembl ID:
ENSDARG00000011487
ZFIN ID:
ZDB-GENE-081104-25
Description:
guanine nucleotide-binding protein G(q) subunit alpha [Source:RefSeq peptide;Acc:NP_001138271]
Human Orthologue:
GNAQ
Human Description:
guanine nucleotide binding protein (G protein), q polypeptide [Source:HGNC Symbol;Acc:4390]
Mouse Orthologue:
Gnaq
Mouse Description:
guanine nucleotide binding protein, alpha q polypeptide Gene [Source:MGI Symbol;Acc:MGI:95776]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2258 Nonsense Mutation detected in F1 DNA During 2014
sa17830 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2258
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013229 Nonsense 237 359 5 7
ENSDART00000013229 Nonsense 237 359 5 7
Genomic Location:
Chromosome 5 (position 56969971)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAAAACGTCACCTCCATCATGTTCCTGGTAGCACTCAGTGAATATGAC[C/T]AAGTTCTCGTCGAGTCTGACAATGAGGTAAATCAAGCACCTACCAACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17830
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013229 Nonsense 263 359 6 7
Genomic Location:
Chromosome 5 (position 56968041)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAATGGAGGAAAGCAAAGCATTGTTTAGGACGATAATAACATACCCCTG[G/A]TTTCAGAATTCATCTGTTATTCTTTTTCTGAACAAGAAAGACCTTTTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vzgrxctp