calcrla

Ensembl ID:
ENSDARG00000011473
ZFIN ID:
ZDB-GENE-040822-26
Description:
Calcitonin gene-related peptide type 1 receptor [Source:UniProtKB/Swiss-Prot;Acc:Q68EK2]
Human Orthologue:
CALCRL
Human Description:
calcitonin receptor-like [Source:HGNC Symbol;Acc:16709]
Mouse Orthologue:
Calcrl
Mouse Description:
calcitonin receptor-like Gene [Source:MGI Symbol;Acc:MGI:1926944]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34724 Nonsense Mutation detected in F1 DNA During 2017
sa41507 Essential Splice Site Mutation detected in F1 DNA During 2017
sa41506 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34724
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024583 Nonsense 94 470 4 13
ENSDART00000123193 Nonsense 98 474 3 12
ENSDART00000144353 Nonsense 98 474 4 13
Genomic Location (Zv9):
Chromosome 9 (position 43443862)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 42569032
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGATGGATGGTTGTGTTGGGATGACACTGAGGCAGGCATCACCTCTGAG[C/T]AACACTGTCCTGACTATTTCCAGGATTTTGACCCTACAGGTTAATATTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41507
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024583 Essential Splice Site 384 470 11 13
ENSDART00000123193 Essential Splice Site 388 474 10 12
ENSDART00000144353 Essential Splice Site 388 474 11 13
Genomic Location (Zv9):
Chromosome 9 (position 43439508)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 42564678
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGCTGAAATATACGACTACATCATGCATATCCTTATGCATTATCAGG[T/G]AAAAAGCTGTCAAATAAGCATAAATTTTAACAATAGAACTACAGAGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41506
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024583 Essential Splice Site 399 470 None 13
ENSDART00000123193 Essential Splice Site 403 474 None 12
ENSDART00000144353 Essential Splice Site 403 474 None 13
Genomic Location (Zv9):
Chromosome 9 (position 43434000)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 42559170
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTGAAGGCTAATGCATTATTTATGCTGACTGAAATCCTGCCTTCCTC[A/G]GGTCCAGGCGGTTTTGAGAAGGCACTGGAATCAGTACCGTATTCAGTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link