LACE1 (1 of 2)

Ensembl ID:
ENSDARG00000011466
Description:
lactation elevated 1 [Source:HGNC Symbol;Acc:16411]
Human Orthologue:
LACE1
Human Description:
lactation elevated 1 [Source:HGNC Symbol;Acc:16411]
Mouse Orthologue:
Lace1
Mouse Description:
lactation elevated 1 Gene [Source:MGI Symbol;Acc:MGI:2148801]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22991 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa10681 Essential Splice Site Available for shipment Available now
sa9539 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22991
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007622 Splice Site, Nonsense 162 471 4 13
Genomic Location:
Chromosome 17 (position 6537169)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAAAAAAAAAGGGTCCATTTTCACGGATTCATGTTGGATGTGCATAAA[C/T]GTAAGTTCAGTTTTTAACAATATGCTGTGAATTTATTGATGATTTTTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10681
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007622 Essential Splice Site 310 471 9 13
Genomic Location:
Chromosome 17 (position 6546618)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAACACTCGATAAGCTGTTTGATGAGATGGCCTTCAAACAGAATGAYAG[T/A]AAGTTGGCCTTTAACACAAACACGCACAYRCACTGAATTTTTCTATATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9539
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007622 Nonsense 421 471 12 13
Genomic Location:
Chromosome 17 (position 6551018)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGTCCATGAACATCACGATGATCACGATCCTCATGAGACCCATGTTT[T/A]ACTGGAMGATCTGGGCATTTCAAGGGTAATTTATGAATCATTTCTTATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8v4rnj14