ENSDARG00000011463

Ensembl ID:
ENSDARG00000011463
Human Orthologues:
F10, F7, F9, PROZ
Human Descriptions:
coagulation factor IX [Source:HGNC Symbol;Acc:3551]
coagulation factor VII (serum prothrombin conversion accelerator) [Source:HGNC Symbol;Acc:3544]
coagulation factor X [Source:HGNC Symbol;Acc:3528]
protein Z, vitamin K-dependent plasma glycoprotein [Source:HGNC Symbol;Acc:9460]
Mouse Orthologues:
F10, F7, F9, Proz
Mouse Descriptions:
coagulation factor IX Gene [Source:MGI Symbol;Acc:MGI:88384]
coagulation factor VII Gene [Source:MGI Symbol;Acc:MGI:109325]
coagulation factor X Gene [Source:MGI Symbol;Acc:MGI:103107]
protein Z, vitamin K-dependent plasma glycoprotein Gene [Source:MGI Symbol;Acc:MGI:1860488]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa28551 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28551
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020921 Nonsense 62 556 2 11
Genomic Location (Zv9):
Chromosome 15 (position 45954185)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 46376118
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTGTGACCCGTTCATCTTCTTGTGTTCTTCCAGATGGAGTTCTGGTAC[A/T]GATATAAGAGTAAGTGTTGAGCTGCAATCAGACTATTTTCTTAATCATTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link