gsna

Ensembl ID:
ENSDARG00000011459
ZFIN ID:
ZDB-GENE-030131-9653
Description:
gelsolin [Source:RefSeq peptide;Acc:NP_001012312]
Human Orthologue:
GSN
Human Description:
gelsolin [Source:HGNC Symbol;Acc:4620]
Mouse Orthologue:
Gsn
Mouse Description:
gelsolin Gene [Source:MGI Symbol;Acc:MGI:95851]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4941 Nonsense F2 line generated During 2017
sa37268 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa4941
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020048   341 729 8 16
ENSDART00000044078   341 728 8 17
ENSDART00000109961 Nonsense 370 373 9 9
ENSDART00000129979 Nonsense 370 373 9 12
Genomic Location (Zv9):
Chromosome 21 (position 16099233)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 17551012
KASP Assay ID:
554-3512.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCAGATTCTCCCAGAAATGGGCGAAACACCCCTTTTCAAGCAGTTCTT[C/T]AAAAACTGGCRTGATGTGGACCAGACAGAGGGCATGGGTGTAGCATATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37268
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020048 Essential Splice Site 471 729 10 16
ENSDART00000044078 Essential Splice Site 470 728 11 17
ENSDART00000109961   None 373 None 9
ENSDART00000129979 Essential Splice Site None 373 11 12
Genomic Location (Zv9):
Chromosome 21 (position 16098666)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 17550445
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATCTTGGGTGCCCAGCTGGATGATGAGCTTGGAGGTGGACCTGTGCAG[G/A]TAATGCATATGAACAAACCGCTTGATCCACTTATTACGTACACATTCGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link