LOC100334017

Ensembl ID:
ENSDARG00000011449
Human Orthologue:
FES
Human Description:
feline sarcoma oncogene [Source:HGNC Symbol;Acc:3657]
Mouse Orthologue:
Fes
Mouse Description:
feline sarcoma oncogene Gene [Source:MGI Symbol;Acc:MGI:95514]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14107 Nonsense Available for shipment Available now
sa12564 Nonsense Available for shipment Available now
sa12523 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14107
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023653 Nonsense 374 828 9 20
Genomic Location:
Chromosome 7 (position 15126623)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAACGCTCTGGAGGACAGCAGGCAGCAGGTGGTTCTGTCTATGGTKGTT[C/T]GAGCTCGTCTGGAGGCCCAGCGGAGGCTTCTGGCAGATAAACTTCAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12564
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023653 Nonsense 673 828 16 20
ENSDART00000023653 Nonsense 673 828 16 20
Genomic Location:
Chromosome 7 (position 15137755)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAGCATGTTGATYAGGATGGCAGAGAACGTGGCGTCAGGCTTGGCGTA[T/G]CTGGAAAGCAAAAAGTGCATTCACCGGTGAGAGGGAAATATGGTGWTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12523
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023653 Nonsense 673 828 16 20
ENSDART00000023653 Nonsense 673 828 16 20
Genomic Location:
Chromosome 7 (position 15137755)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAGCATGTTGATYAGGATGGCAGAGAACGTGGCGTCAGGCTTGGCGTA[T/G]CTGGAAAGCAAAAAGTGCATTCACCGGTGAGAGGGAAATATGGTGWTGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zi6ficbz