si:dkey-12h9.13

Ensembl ID:
ENSDARG00000011445
ZFIN ID:
ZDB-GENE-041001-151
Description:
hypothetical protein LOC569908 [Source:RefSeq peptide;Acc:NP_001038658]
Human Orthologue:
C14orf43
Human Description:
chromosome 14 open reading frame 43 [Source:HGNC Symbol;Acc:19853]
Mouse Orthologue:
C130039O16Rik
Mouse Description:
RIKEN cDNA C130039O16 gene Gene [Source:MGI Symbol;Acc:MGI:2685106]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17680 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17680
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024821 Nonsense 433 1016 1 12
ENSDART00000128908   None 224 None 2
ENSDART00000142611 Nonsense 433 976 2 13
Genomic Location (Zv9):
Chromosome 20 (position 25927634)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 25998937
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACAGTGGGGGTCATCCAGAGYACTCWGAGAAGACGAAGAGCCTCAAAA[G/T]AGATCAACCTTGAGACTCTTGCWCAGCAGGCTTCAGAAATGGAATTTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link