ryr1a

Ensembl ID:
ENSDARG00000011422
ZFIN ID:
ZDB-GENE-020108-2
Description:
Ryanodine receptor 1a [Source:UniProtKB/TrEMBL;Acc:A7M793]
Human Orthologue:
RYR1
Human Description:
ryanodine receptor 1 (skeletal) [Source:HGNC Symbol;Acc:10483]
Mouse Orthologue:
Ryr1
Mouse Description:
ryanodine receptor 1, skeletal muscle Gene [Source:MGI Symbol;Acc:MGI:99659]

Alleles

There are 17 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41692 Nonsense Mutation detected in F1 DNA During 2016
sa21768 Nonsense Mutation detected in F1 DNA During 2016
sa41693 Nonsense Mutation detected in F1 DNA During 2016
sa21769 Essential Splice Site Available for shipment Available now
sa34941 Essential Splice Site Mutation detected in F1 DNA During 2016
sa24879 Nonsense Mutation detected in F1 DNA During 2016
sa16264 Nonsense Available for shipment Available now
sa12583 Nonsense Available for shipment Available now
sa1535 Nonsense F2 line generated During 2016
sa17197 Nonsense Available for shipment Available now
sa34942 Essential Splice Site Mutation detected in F1 DNA During 2016
sa34943 Essential Splice Site Mutation detected in F1 DNA During 2016
sa18239 Nonsense Available for shipment Available now
sa13565 Essential Splice Site Available for shipment Available now
sa41694 Essential Splice Site Mutation detected in F1 DNA During 2016
sa9332 Nonsense Mutation detected in F1 DNA During 2016
sa18990 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa41692
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Nonsense 239 5056 9 105
ENSDART00000137089 Nonsense 205 5028 8 104
Genomic Location:
Chromosome 10 (position 34448131)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTGGAGGGCATGTTCTTCGTCTATTTCACGGGCACATGGATGAGTGTT[T/G]AACAATTCCTGGCGCGGAGCAGGGCGACGATCAGAGACGGTGAGATACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21768
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Nonsense 365 5056 12 105
ENSDART00000137089 Nonsense 331 5028 11 104
Genomic Location:
Chromosome 10 (position 34450135)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGTATGGCGAGTCCATGTGCTTTGTGCAGCACGTCGCTACAAGTCTGT[G/A]GCTCACATATGCCTCGGTGGATGCCAAGTCTGCTCGGCTGGGACCACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41693
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Nonsense 458 5056 14 105
ENSDART00000137089 Nonsense 424 5028 13 104
Genomic Location:
Chromosome 10 (position 34452171)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTGCCTCTAGACGCCATAGTTCTGTCATTGCAGGATCTCATCTTCTA[T/A]TTCCGACCTCCAGAAGAGGAGCTGGAACATGAGGAGAAGCAGACCAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21769
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Essential Splice Site 534 5056 15 105
ENSDART00000137089 Essential Splice Site 500 5028 14 104
Genomic Location:
Chromosome 10 (position 34452527)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGCCGAGTCGTGGAAAGAGATCGTCAACTTATTTTATGAGCTGCTGGG[T/C]TTGTCTCTGTTTACTCATGATTGTATGATGCAATTTAAAATGATGTACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34941
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Essential Splice Site 902 5056 22 105
ENSDART00000137089 Essential Splice Site 868 5028 21 104
Genomic Location:
Chromosome 10 (position 34458209)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAGCTGTGGGCCGTCACTCGAATTGAACAGGGTTGGACATATGGACTA[G/A]TGAGTTTTTGAAAAAATTACATCAAGTATTAATATAATCCAAGGCTATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24879
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Nonsense 1206 5056 29 105
ENSDART00000137089 Nonsense 1172 5028 28 104
Genomic Location:
Chromosome 10 (position 34465539)
KASP Assay ID:
554-7528.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTTTATACTCACCAGGCTTCATCCCTGTATGCAGTCTGGGTATGTCC[C/T]AGGTGGGTCGGATCAACCTTGGTCAAAATGTGAGCAGCCTGCGGTACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16264
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Nonsense 1884 5056 37 105
ENSDART00000137089 Nonsense 1850 5028 36 104
Genomic Location:
Chromosome 10 (position 34479394)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCTGAACAGCAGCTGGTCTGCAAAGAGGAAGGAGCGGAGGTAAAAGAG[C/T]AAGAGGAACCAGCAGACGGTGGAAATGATGGAGAGYTGCTGGATGAAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12583
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Nonsense 2054 5056 39 105
ENSDART00000137089 Nonsense 2020 5028 38 104
Genomic Location:
Chromosome 10 (position 34481948)
KASP Assay ID:
2260-3439.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAACTATATTTTATATACAGGTGAACATGTTGATGAACTTTAAGAACTG[T/A]CCAGAGGAAGAAGATTGCCCCGTTCCWGAGGATGTCCGGAATGGCCTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1535
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Nonsense 2234 5056 42 105
ENSDART00000137089 Nonsense 2200 5028 41 104
Genomic Location:
Chromosome 10 (position 34489748)
KASP Assay ID:
554-1458.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTTTCAGAAATATTATGAGTAACAGGGTATTTTACCAGCACCCCAACT[T/A]GATGAGAGCTCTGGGAATGCATGAGACAGTCATGGAGGTTATGGTGAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17197
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Nonsense 2368 5056 45 105
ENSDART00000137089 Nonsense 2334 5028 44 104
Genomic Location:
Chromosome 10 (position 34493105)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAAGGGTTACCCGGATATTGGATGGAACCCAGTTGGAGGAGAAAAGTA[T/G]CTGGAYTTCCTGCGCTTTGCTGTGTTTGTGAATGGTTTGTAAAATATATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34942
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Essential Splice Site 2380 5056 45 105
ENSDART00000137089 Essential Splice Site 2346 5028 44 104
Genomic Location:
Chromosome 10 (position 34493141)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGGAGAAAAGTATCTGGATTTCCTGCGCTTTGCTGTGTTTGTGAATGG[T/C]TTGTAAAATATATGGTTGTATCTCTCTTTAAAAAAGTGTTTAGTTTACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34943
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Essential Splice Site 2576 5056 49 105
ENSDART00000137089 Essential Splice Site 2542 5028 48 104
Genomic Location:
Chromosome 10 (position 34495686)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGAAGTGGGTTTCCTGCCTGATATGAGGGCGGCAGCCTCCTTAGACACA[G/T]TAAGATGCACACCATACCTTTTTTACTAACATTTACTACATTTAAATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18239
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Nonsense 2894 5056 57 105
ENSDART00000137089 Nonsense 2860 5028 56 104
Genomic Location:
Chromosome 10 (position 34499012)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGTTYTCTTACTTTCTTAAWAGGCAACCTATGACCCCAGTCATGGCTA[T/G]AGCCCCCAACCTATTGATATCTCAGGCAKGACACTGTCCAGAGAGCTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13565
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Essential Splice Site 2911 5056 57 105
ENSDART00000137089 Essential Splice Site 2877 5028 56 104
Genomic Location:
Chromosome 10 (position 34499064)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCCCCAACCTATTGATATCTCAGGCAKGACACTGTCCAGAGAGCTACAG[G/A]TACACAATACAACATCAACTTAGAMTTAAAGAGCCCCTATTATGCATTNA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41694
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Essential Splice Site 4030 5056 88 105
ENSDART00000137089 Essential Splice Site 4002 5028 87 104
Genomic Location:
Chromosome 10 (position 34544637)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTGGGCTTTCTGCACGTGTTTGCTCATATGATGATGAAACTGGCTCAG[G/A]TAACCCACATAAACTTGATTGTACTGTTGCTCATTTCATTCTATCTGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9332
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Nonsense 4193 5056 90 105
ENSDART00000137089 Nonsense 4165 5028 89 104
ENSDART00000014749 Nonsense 4193 5056 90 105
ENSDART00000137089 Nonsense 4165 5028 89 104
Genomic Location:
Chromosome 10 (position 34547838)
KASP Assay ID:
2260-3444.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGAACATGTTCCTCACGATACAAGACTGCAGAACTTCCTCGAAMAAGCC[G/T]AGAGCGTCCTGAACTATTTCCGCCCATTCTTGGGTCGCATCGAGATCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18990
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014749 Nonsense 4193 5056 90 105
ENSDART00000137089 Nonsense 4165 5028 89 104
ENSDART00000014749 Nonsense 4193 5056 90 105
ENSDART00000137089 Nonsense 4165 5028 89 104
Genomic Location:
Chromosome 10 (position 34547838)
KASP Assay ID:
2260-3444.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGAACATGTTCCTCACGATACAAGACTGCAGAACTTCCTCGAACAAGCC[G/T]AGAGCGTCCTGAACTATTTCCGCCCATTCTTGGGTCGCATCGAGATCATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link