LOC100333692

Ensembl ID:
ENSDARG00000011407
Human Orthologue:
COL2A1
Human Description:
collagen, type II, alpha 1 [Source:HGNC Symbol;Acc:2200]
Mouse Orthologue:
Col2a1
Mouse Description:
collagen, type II, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88452]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9187 Essential Splice Site Mutation detected in F1 DNA During 2014
sa13949 Essential Splice Site Available for shipment Available now
sa9455 Nonsense Available for shipment Available now
sa16061 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9187
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047844 Essential Splice Site 158 1257 11 47
Genomic Location:
Chromosome 11 (position 114051)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGTTGGTACAGCAGGATCTCCCGGGTTCCCAGGATCCCCCGGTGCAAAG[G/A]TGTGACCTCTCTTGATTCCTCTATCAATGATCCCTCATGTCTCTGCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13949
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047844 Essential Splice Site 411 1257 21 47
Genomic Location:
Chromosome 11 (position 109945)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTKGAAAGGCTGGAGAGAAGGGACTCGCTGGAGCTCCGGGTCTGCGTG[T/A]AAGTGTTGATTTGCAGCTTCATAAACTCMGAGAAACGAGCGGACACACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9455
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047844 Nonsense 674 1257 34 47
Genomic Location:
Chromosome 11 (position 106131)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTTTTAAAATGTTTGCAGGGTGCCACGGGTTTCCCCGGAGCCGCTRGA[A/T]GAGTTGGACCTCCTGGTCCTAATGTAAGAAAAGCAATAGAAAGCAAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16061
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047844 Essential Splice Site 861 1257 39 47
Genomic Location:
Chromosome 11 (position 104207)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCTGGTCCAGTMGGACCCACTGGTAAWCAGGGAGACAGAGGRGAGGCR[G/A]TAAGTACAGATTTTTACAGCTCTTCATGACGTGTAGAATAAAATGTATGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r537x02j