fen1

Ensembl ID:
ENSDARG00000011404
ZFIN ID:
ZDB-GENE-031112-11
Description:
Fen1 proteinFlap structure-specific endonuclease 1 [Source:UniProtKB/TrEMBL;Acc:Q6TNU4]
Human Orthologue:
FEN1
Human Description:
flap structure-specific endonuclease 1 [Source:HGNC Symbol;Acc:3650]
Mouse Orthologue:
Fen1
Mouse Description:
flap structure specific endonuclease 1 Gene [Source:MGI Symbol;Acc:MGI:102779]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15638 Essential Splice Site Available for shipment Available now
sa24456 Nonsense Mutation detected in F1 DNA During 2014
sa4275 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15638
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024224 Essential Splice Site 118 380 5 12
Genomic Location:
Chromosome 24 (position 11685887)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAGACGAGCAGAGGCTGAGAAACTTCTAGCTCAGGCACAAGAAGCAGG[T/C]ACAGACACCATCAAAAATGTACTTTTTCATAAAAAAAATATAATTTTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24456
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024224 Nonsense 214 380 8 12
Genomic Location:
Chromosome 24 (position 11686467)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATTTTAGAAAGCTCCCCATCCAAGAGTTTCACTTCAGTCGTATTCTG[C/T]AGGATATGGAGCTGACGCATCAACAGGTGAGTAATATATCAACATGTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4275
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024224 Essential Splice Site 356 380 12 12
Genomic Location:
Chromosome 24 (position 11691603)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTRTTGTTAAAACTTTTTAACACTTATAAATTTGTCTTGTTTTTCCCTA[G/T]GAGCCTGAAACAAAGGGATCTGCCAAAAAGAAACAAAAGACAAGTGCTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Metabolite levels: Genetic variants associated with glycine metabolism and their role in insulin sensitivity and type 2 diabetes. (View Study)
  • Phospholipid levels (plasma): Genetic loci associated with plasma phospholipid n-3 fatty acids: a meta-analysis of genome-wide association studies from the CHARGE Consortium. (View Study)
  • Platelet counts: New gene functions in megakaryopoiesis and platelet formation. (View Study)
  • Stearic acid (18:0) plasma levels: Genome-wide association study identifies novel loci associated with concentrations of four plasma phospholipid fatty acids in the de novo lipogenesis pathway: results from the Cohorts for Heart and Aging Research in Genomic Epidemiology (CHARGE) consortium. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/igo86x3i