tnnc1a

Ensembl ID:
ENSDARG00000011400
ZFIN ID:
ZDB-GENE-030523-1
Description:
troponin C, slow skeletal and cardiac muscles [Source:RefSeq peptide;Acc:NP_852475]
Human Orthologue:
TNNC1
Human Description:
troponin C type 1 (slow) [Source:HGNC Symbol;Acc:11943]
Mouse Orthologues:
AC154446.1, Tnnc1
Mouse Descriptions:
troponin C, cardiac/slow skeletal Gene [Source:MGI Symbol;Acc:MGI:98779]
troponin C, slow skeletal and cardiac muscles [Source:RefSeq peptide;Acc:NP_033419]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25192 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15521 Essential Splice Site Available for shipment Available now
sa14726 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25192
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023537 Essential Splice Site 8 161 1 6
Genomic Location:
Chromosome 23 (position 4946491)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGCACTTCATCTGATCTTCTCACAATGAACGACATCTACAAAGCAGCGG[T/A]GAGTCTTGGGTCTTTTTTCGTGCTTTGAGTTTTAAACAAAGTTTCACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15521
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023537 Essential Splice Site 106 161 4 6
Genomic Location:
Chromosome 23 (position 4950413)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGGAAGGCCWGAGGAAGAACTGGCGGAACTCTTCCGTATGTTTGACAA[G/A]TRCGTCTGTCTTTACACCAAATTCCRAGAGCAAACTGGTGTTGGGTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14726
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023537 Nonsense 146 161 5 6
Genomic Location:
Chromosome 23 (position 4950616)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAAGATGACATTGAGGAACTGATGAGGGACGGAGACAAAAACAATGAC[G/T]GAAAAATTGATTATGATGGTAAGCANNTGTTTTTATTTANNNNNNNNNNN
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/uwc1x2zg