D1LXJ2_DANRE

Ensembl ID:
ENSDARG00000011390
Description:
Natriuretic peptide receptor B [Source:UniProtKB/TrEMBL;Acc:D1LXJ2]
Human Orthologue:
NPR2
Human Description:
natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide receptor B) [Source:HGN
Mouse Orthologue:
Npr2
Mouse Description:
natriuretic peptide receptor 2 Gene [Source:MGI Symbol;Acc:MGI:97372]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12949 Nonsense Available for shipment Available now
sa16130 Nonsense Available for shipment Available now
sa20555 Essential Splice Site Available for shipment Available now
sa40579 Nonsense Mutation detected in F1 DNA During 2017
sa15464 Nonsense Available for shipment Available now
sa38516 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa12949
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019439 Nonsense 39 1046 1 23
Genomic Location (Zv9):
Chromosome 5 (position 62862059)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 53939016
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAAAGGCAATATTACTGTCGCGGTGRTGCTGCCCGAAAAYCTGAAGTA[T/A]TCTTGGGCWTCGCCGCGCGTCCTCCCCGCTATCCGTATGGCGCAAGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16130
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019439 Nonsense 215 1046 1 23
Genomic Location (Zv9):
Chromosome 5 (position 62861531)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 53939544
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGAAAACATYACAGTGTTGGCTTTCCCTTATGAAGACGAACAAWCTTA[T/A]AATTATAAAGATATGATCACATTTATAAAGGACAACGGCAGAAGTAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20555
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019439 Essential Splice Site 230 1046 1 23
Genomic Location (Zv9):
Chromosome 5 (position 62861486)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 53939589
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTATAATTATAAAGATATGATCACATTTATAAAGGACAACGGCAGAAG[T/C]AAGTTTAGTTTAAGTTACCATATGCCCTTACTACTAGAAATAAAAAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40579
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019439 Nonsense 307 1046 3 23
Genomic Location (Zv9):
Chromosome 5 (position 62845043)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 53956032
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTAGTCTGTGTTCGTTGTAACATACCAGGAGCCAGACAGCCCTGAGTA[T/A]ACCGCTTTCCGCAAAGAACTCCACAAAAGAGCAATACAAGACTTTAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15464
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019439 Nonsense 522 1046 9 23
Genomic Location (Zv9):
Chromosome 5 (position 62826357)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 53974718
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TWATGGTGTTGCATTCTTTCTGTGTTTCCTTTCCAGAGAGGTTCCAGCTA[T/G]GGCTCCTTGATAACAGCTCATGGAAAATATCAGCTATTTGCAAAAACAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38516
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019439 Nonsense 540 1046 9 23
Genomic Location (Zv9):
Chromosome 5 (position 62826303)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 53974772
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTTGATAACAGCTCATGGAAAATATCAGCTATTTGCAAAAACAGGCTA[T/A]TTTAAGGTAAGGCTGAGTTCTTCCTCCCTCTGCTGCACACCCACACACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link