mknk2a

Ensembl ID:
ENSDARG00000011373
ZFIN ID:
ZDB-GENE-030131-6099
Description:
MAP kinase-interacting serine/threonine kinase 2 [Source:RefSeq peptide;Acc:NP_997888]
Human Orthologue:
MKNK2
Human Description:
MAP kinase interacting serine/threonine kinase 2 [Source:HGNC Symbol;Acc:7111]
Mouse Orthologue:
Mknk2
Mouse Description:
MAP kinase-interacting serine/threonine kinase 2 Gene [Source:MGI Symbol;Acc:MGI:894279]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8082 Nonsense Mutation detected in F1 DNA During 2014
sa9168 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19738 Nonsense Mutation detected in F1 DNA During 2014
sa11542 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa8082
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027782 Nonsense 3 472 2 14

The following transcripts of ENSDARG00000011373 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 22465334)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGATTTAGACNNNNNNCTGCACATCATTGGACCTTTGGAAAACATGGTG[C/T]AAAACAAGATCACTGAAGTAACCGGATTCCATCGCTCCTTTAAGGTTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9168
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027782 Essential Splice Site 80 472 4 14

The following transcripts of ENSDARG00000011373 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 22465867)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGAAAAAGAGATGCAGAGCCACTGACAGTTTTTCCGGACGTTTTGAAG[G/A]CAAGCGGTTTTGTCWGTCCTCAAGTTTGCAGTTGAGCTTTACTATCTKTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19738
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027782 Nonsense 349 472 12 14

The following transcripts of ENSDARG00000011373 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 22479593)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATTGGGCACACATCTCCCCTGCAGCCAAAGACCTCATCACCAAACTAT[T/A]GGTACGGGATGCCAAAGACCGCCTCAGTGCCGCCCAAGTCCTGCAGCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11542
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027782 Essential Splice Site 384 472 13 14

The following transcripts of ENSDARG00000011373 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 22480375)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTTTAGTGTGCACCCAACACTGTGTCTGCATCYATACTACATCAGAG[G/A]TATGTATAGTGCNNNCTTATACTCCTCTAAATCTCATSCAGCAAACATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qn3fbrro