fyna

Ensembl ID:
ENSDARG00000011370
ZFIN IDs:
ZDB-GENE-030903-5, ZDB-GENE-030903-5
Description:
FYN oncogene related to SRC, FGR, YES a [Source:RefSeq peptide;Acc:NP_001007287]
Human Orthologue:
FYN
Human Description:
FYN oncogene related to SRC, FGR, YES [Source:HGNC Symbol;Acc:4037]
Mouse Orthologue:
Fyn
Mouse Description:
Fyn proto-oncogene Gene [Source:MGI Symbol;Acc:MGI:95602]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14225 Nonsense Available for shipment Available now
sa42896 Missense, Nonsense Mutation detected in F1 DNA During 2016
sa36364 Essential Splice Site Mutation detected in F1 DNA During 2016
sa36363 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14225
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023320 Nonsense 28 536 3 15
ENSDART00000046414 Nonsense 28 293 3 10
Genomic Location (Zv9):
Chromosome 17 (position 15364952)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15515780
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAAACTCACAGACGAAAGAGAAACTAGYGTCTCGCAGCATGCGGGATA[T/G]CGATATGGGTCTGATCCGACTCCTCAGCACTACCCCAGCTTTGGAGTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42896
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023320 Nonsense 130 536 6 15
ENSDART00000046414 Missense 130 293 5 10
Genomic Location (Zv9):
Chromosome 17 (position 15360766)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15511594
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCAGGGAAGGAGACTGGTGGGAGGCACGCTCTCTCACTACAGGTGGAA[C/T]AGGATACATACCCAGTAATTATGTGGCTCCAGTCGACTCCATACAGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36364
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023320 Essential Splice Site 182 536 8 15
ENSDART00000046414 Essential Splice Site 183 293 6 10
Genomic Location (Zv9):
Chromosome 17 (position 15360439)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15511267
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAAATCCCAGAGGCACTTTCCTTATAAGGGAGAGTGAGACCACGAAAGG[T/C]AATTTGGATTTGCACAAACCAGTTCATACTGTAGTTTATGCTACCATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36363
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023320 Nonsense 423 536 13 15
ENSDART00000046414   None 293 None 10
Genomic Location (Zv9):
Chromosome 17 (position 15351539)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 15502367
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATTTCGGACTGGCCAGACTAATAGAAGACAATGAATACACAGCACGA[C/T]AAGGTGAGGCTTACACTCCAAAATTGTAGCTACACTTTTTTATTGTCTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link