nfatc2ip

Ensembl ID:
ENSDARG00000011360
ZFIN ID:
ZDB-GENE-030131-9520
Description:
Nfatc2ip protein [Source:UniProtKB/TrEMBL;Acc:Q5BLI6]
Human Orthologue:
NFATC2IP
Human Description:
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein [Sourc
Mouse Orthologue:
Nfatc2ip
Mouse Description:
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein Gene [

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40020 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38377 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40020
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011320 Essential Splice Site 11 353 None 9
ENSDART00000130230 Essential Splice Site 33 375 None 9

The following transcripts of ENSDARG00000011360 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 15091625)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15337231
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGCGCGCACGGGAATGAGCCCGCACAAAAGGACTATGGCTGAAACGG[T/C]GAGTTCTCGGTTAAAACAGTTATTCAGTTTTGGTTTTTATTTATTGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38377
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011320 Nonsense 131 353 5 9
ENSDART00000130230 Nonsense 153 375 5 9

The following transcripts of ENSDARG00000011360 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 15085305)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 15330911
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCATGTAGTCCGCCAGTGAAACGGAGCAGGCGGGCCAACCAAAAAATG[C/T]GGTGAGTAATTAAATTAGATTTCTTCATTCAGTCTTTAATGTTCTATTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link