LOC100334768

Ensembl ID:
ENSDARG00000011333
Human Orthologue:
ARHGAP33
Human Description:
Rho GTPase activating protein 33 [Source:HGNC Symbol;Acc:23085]
Mouse Orthologue:
Arhgap33
Mouse Description:
Rho GTPase activating protein 33 Gene [Source:MGI Symbol;Acc:MGI:2673998]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36246 Nonsense Mutation detected in F1 DNA During 2016
sa9276 Nonsense Mutation detected in F1 DNA During 2016
sa36245 Essential Splice Site Mutation detected in F1 DNA During 2016
sa42808 Essential Splice Site Mutation detected in F1 DNA During 2016
sa17463 Essential Splice Site Available for shipment Available now
sa12075 Nonsense Available for shipment Available now
sa19150 Nonsense Mutation detected in F1 DNA During 2016
sa19149 Nonsense Mutation detected in F1 DNA During 2016
sa36244 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36246
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022270 Nonsense 50 1964 1 24
Genomic Location (Zv9):
Chromosome 16 (position 47713334)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 44911530
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGGCTCGTGTATCAACATCAACCTGTCTGACAAACAACTGAGAGAATA[C/A]ACACATCAACACCAGGAGAAAATGCAGCGAAGAGTCACATGTGAGTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9276
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022270 Nonsense 186 1964 6 24
Genomic Location (Zv9):
Chromosome 16 (position 47654752)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 44852948
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACCTCGGGCAGTGCCAAAGATCTGGTTTTCCTCGTGCAGGTGTCCTGC[C/T]AGGTGAGTGGGCGCACATTCACCAGACGCCGCTAATTATAAACAMCCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36245
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022270 Essential Splice Site 263 1964 8 24
Genomic Location (Zv9):
Chromosome 16 (position 47652471)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 44850667
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATTGTGGACAATAAGCTGAACTGTGGGCCGGTTCTCACTTGGATGGAG[G/A]TAAGAGACAAACAGGGGGCCGTAAACATGTATTAAAGCAGTAAAATATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42808
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022270 Essential Splice Site 330 1964 10 24
Genomic Location (Zv9):
Chromosome 16 (position 47649807)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 44848003
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGCCCAAAGAGGACACTACATGGTGGAGAGGAAAGCATGGATTTCAGG[T/A]ACTGTTCTTAATCTCAGATCCTCATTTCCCCCCCTTTTTAGTAAAACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17463
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022270 Essential Splice Site 512 1964 15 24
ENSDART00000022270 Essential Splice Site 512 1964 15 24
Genomic Location (Zv9):
Chromosome 16 (position 47636784)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 44834980
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGCTGCCCAATCCATTGCTCACATACCAGCTTTACGACAAGTTTGCTG[T/C]AAGTCATTCTGTCTCTAGCAGATATAAGACCARGGGATGATGTACATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12075
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022270 Nonsense 626 1964 19 24
ENSDART00000022270 Nonsense 626 1964 19 24
Genomic Location (Zv9):
Chromosome 16 (position 47628728)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 44826924
KASP Assay ID:
2261-0258.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAYCWGAATCTAAATCTTTTTCTTGCATTYGTTTTCTRACTTGACAGCA[C/T]GACAGTCCCTGACCAGGCCCAAGTCGTTTGTATCCACCAGGCTCCTGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19150
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022270 Nonsense 626 1964 19 24
ENSDART00000022270 Nonsense 626 1964 19 24
Genomic Location (Zv9):
Chromosome 16 (position 47628728)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 44826924
KASP Assay ID:
2261-0258.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATCTGAATCTAAATCTTTTTCTTGCATTTGTTTTCTGACTTGACAGCA[C/T]GACAGTCCCTGACCAGGCCCAAGTCGTTTGTATCCACCAGGCTCCTGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19149
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022270 Nonsense 692 1964 20 24
Genomic Location (Zv9):
Chromosome 16 (position 47628336)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 44826532
KASP Assay ID:
2261-0257.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTAGAAGGAAAAGAGGGATGAAGGTGCGGAAGTCAGCGGGTGGAAGCTG[G/A]AAGACATTTTTTGCCATTGGGAAACCTGGGGCTGTAGGTCGACGCAAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36244
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022270 Nonsense 825 1964 22 24
Genomic Location (Zv9):
Chromosome 16 (position 47626215)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 44824411
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGAAGACGAAGAGGATGAGGAGGGTGTGTACATGCTGCCTGATTTCTCC[C/T]AGGAACCACCCTCTTCATGGATAACGGAGGATGTCATTGACTTTAGCCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link