nae1

Ensembl ID:
ENSDARG00000011301
ZFIN ID:
ZDB-GENE-040426-1552
Description:
NEDD8-activating enzyme E1 regulatory subunit [Source:UniProtKB/Swiss-Prot;Acc:Q7SXP2]
Human Orthologue:
NAE1
Human Description:
NEDD8 activating enzyme E1 subunit 1 [Source:HGNC Symbol;Acc:621]
Mouse Orthologue:
Nae1
Mouse Description:
NEDD8 activating enzyme E1 subunit 1 Gene [Source:MGI Symbol;Acc:MGI:2384561]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34155 Essential Splice Site Mutation detected in F1 DNA During 2017
sa40985 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34155
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019270 Essential Splice Site 72 533 3 20
Genomic Location (Zv9):
Chromosome 7 (position 45780022)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 44452850
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACCATTGTAGACGGGCACAAAGTTTCAGGGGAGGATGTTGGAAACAAG[T/A]AAATGTGTTGGCGTGATGATGTATATCTTTTTTGGAAATATAATATGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40985
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019270 Nonsense 437 533 17 20
Genomic Location (Zv9):
Chromosome 7 (position 45768978)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 44441806
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAGATGGTTCTGTACCTTATGCTCCGCTCAGTCGACCGCTTCTATCAG[C/T]AACACTCCCGCTACCCAGGTCAGAAGTAATCAGAGTAATCAGAACAGACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link