atf7a

Ensembl ID:
ENSDARG00000011298
ZFIN ID:
ZDB-GENE-050721-2
Description:
cyclic AMP-dependent transcription factor ATF-7 [Source:RefSeq peptide;Acc:NP_001025376]
Human Orthologue:
ATF7
Human Description:
activating transcription factor 7 [Source:HGNC Symbol;Acc:792]
Mouse Orthologue:
Atf7
Mouse Description:
activating transcription factor 7 Gene [Source:MGI Symbol;Acc:MGI:2443472]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37731 Nonsense Mutation detected in F1 DNA During 2016
sa5054 Nonsense Mutation detected in F1 DNA During 2016
sa43995 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa37731
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013563 Nonsense 157 497 5 11
Genomic Location:
Chromosome 23 (position 27699275)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTGGCTGATTATCGTCGCAGGATTCTCCTCCAAGGCATGCCTTCAGTT[C/A]AGCTCCAACCCCAGCCATAGTGCGTCCTGGATCCCTCCCTCTGCACCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5054
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013563 Nonsense 304 497 8 11
Genomic Location:
Chromosome 23 (position 27695716)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTTGGTGTGGCGATGGGCTCTAGTGCAATGGTGCCTCAGAGGGTGGAG[C/T]AAAGCCAGCTGCTGGTTCAGCATCCAGATGCTCCATCACCTGCYCAGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43995
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013563 Nonsense 407 497 10 11
Genomic Location:
Chromosome 23 (position 27688776)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAAACGAAGTTGCTCATCTAAAGCAGTTGCTGTTAGCCCATAAAGACTG[T/A]CCTGTCACCAACCTCCAGAAGAAAGCTGCCTATTTAGGTAAGTAGAGCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: A genome-wide association study in 19 633 Japanese subjects identified LHX3-QSOX2 and IGF1 as adult height loci. (View Study)
  • Height: Identification, replication, and fine-mapping of Loci associated with adult height in individuals of african ancestry. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link