osbpl1a

Ensembl ID:
ENSDARG00000011281
ZFIN ID:
ZDB-GENE-050208-657
Description:
oxysterol-binding protein-related protein 1 [Source:RefSeq peptide;Acc:NP_001038547]
Human Orthologue:
OSBPL1A
Human Description:
oxysterol binding protein-like 1A [Source:HGNC Symbol;Acc:16398]
Mouse Orthologue:
Osbpl1a
Mouse Description:
oxysterol binding protein-like 1A Gene [Source:MGI Symbol;Acc:MGI:1927551]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25178 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39365 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37474 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25178
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090468 Essential Splice Site 133 967 5 28
ENSDART00000111318 Essential Splice Site 133 972 5 29
Genomic Location (Zv9):
Chromosome 22 (position 16548134)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16299888
KASP Assay ID:
554-7338.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCCTAAAGACATTACACAGAGTGCCGAGATTAAAAGCATGCTGGAGGG[T/C]AAGCTTGAACAACACAAAGAATGACAGTGCTGTGGAATCTACCTTTGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39365
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090468 Essential Splice Site 247 967 9 28
ENSDART00000111318 Essential Splice Site 247 972 9 29
Genomic Location (Zv9):
Chromosome 22 (position 16550331)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16302085
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGGCATGACACGGCATGTTAAAATGTTTGAAGGGCCTCTTTGGAAGG[T/A]ATTTAAAGTGTTTATCTATAGTATGGCTATGTATTTGGCTATGTATTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37474
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090468 Essential Splice Site 653 967 21 28
ENSDART00000111318 Essential Splice Site 653 972 21 29
Genomic Location (Zv9):
Chromosome 22 (position 16564049)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 16315803
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAGTCTGTTGTGCGGTTGAGAATATTCACCATGCCCCTCAACTTTGTA[G/T]GGATGATCTTGATTTCCGGCTGATATCTGAACAAGTGAGCCACCATCCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Osteoporosis: An integration of genome-wide association study and gene expression profiling to prioritize the discovery of novel susceptibility Loci for osteoporosis-related traits. (View Study)
  • Protein quantitative trait loci: A genome-wide association study identifies protein quantitative trait loci (pQTLs). (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link