traip

Ensembl ID:
ENSDARG00000011262
ZFIN ID:
ZDB-GENE-040801-30
Description:
TRAF-interacting protein [Source:RefSeq peptide;Acc:NP_991170]
Human Orthologue:
TRAIP
Human Description:
TRAF interacting protein [Source:HGNC Symbol;Acc:30764]
Mouse Orthologue:
Traip
Mouse Description:
TRAF-interacting protein Gene [Source:MGI Symbol;Acc:MGI:1096377]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21949 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21949
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017393 Nonsense 7 453 2 16
Genomic Location:
Chromosome 11 (position 36011674)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAACAGAGATGTCTCTTTCAGATCAACAATGCCCATTCGAGCATACTG[C/A]ACAATCTGCTCAGATTTCTTCGACCATTCTAAAGATGTGGCTGCAATTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zs5isv4g