trpm1

Ensembl ID:
ENSDARG00000011259
ZFIN ID:
ZDB-GENE-070112-1372
Description:
transient receptor potential cation channel, subfamily M, member 1 [Source:RefSeq peptide;Acc:NP_00
Human Orthologue:
TRPM1
Human Description:
transient receptor potential cation channel, subfamily M, member 1 [Source:HGNC Symbol;Acc:7146]
Mouse Orthologue:
Trpm1
Mouse Description:
transient receptor potential cation channel, subfamily M, member 1 Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10704 Essential Splice Site Available for shipment Available now
sa10436 Nonsense Available for shipment Available now
sa11580 Essential Splice Site Available for shipment Available now
sa38616 Nonsense Mutation detected in F1 DNA During 2016
sa20961 Nonsense Available for shipment Available now
sa40909 Missense, Splice Site Mutation detected in F1 DNA During 2016
sa15286 Nonsense Available for shipment Available now
sa40908 Nonsense Mutation detected in F1 DNA During 2016
sa30632 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa10704
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052584   None 1546 None 25
ENSDART00000086664   None 319 None 9
ENSDART00000140938   None 297 None 8
ENSDART00000147251 Essential Splice Site None 191 1 6
ENSDART00000147919   None 1306 None 24
Genomic Location (Zv9):
Chromosome 7 (position 30677786)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29070128
KASP Assay ID:
2259-8936.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAGTCTGGCTTWATGTAAGCCTTTGGTCTTTCTCTTTAACTTCAAGGG[T/C]AAGTTCTAGAGTAGTATATNNGTACTACAACCTGTTTGCCTACCAGACTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10436
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052584   None 1546 None 25
ENSDART00000086664   None 319 2 9
ENSDART00000140938   None 297 2 8
ENSDART00000147251   None 191 2 6
ENSDART00000147919 Nonsense 26 1306 1 24
Genomic Location (Zv9):
Chromosome 7 (position 30676864)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29069206
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTTCTAAAAAGAGAGWGCAATCATATATTCCCCAGCAAAGAGCCCAAC[A/T]AGTCAGTAGCAATGTTTTTATTGTATTGYTCATACTCCTGGGGTATGAAY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11580
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052584 Essential Splice Site 22 1546 2 25
ENSDART00000086664 Essential Splice Site 22 319 4 9
ENSDART00000140938 Essential Splice Site 22 297 4 8
ENSDART00000147251 Essential Splice Site 22 191 4 6
ENSDART00000147919 Essential Splice Site 93 1306 3 24
Genomic Location (Zv9):
Chromosome 7 (position 30676076)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29068418
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAACATTTGATCAATTAAAATCTTCTCATYACTTTCTTSCTTGTTATTA[G/A]TATATCCGTGTGTCCTACGATACGAAACCGGATAACCTTCTGCATTTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38616
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052584 Nonsense 68 1546 2 25
ENSDART00000086664 Nonsense 68 319 4 9
ENSDART00000140938 Nonsense 68 297 4 8
ENSDART00000147251 Nonsense 68 191 4 6
ENSDART00000147919 Nonsense 139 1306 3 24
Genomic Location (Zv9):
Chromosome 7 (position 30675937)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29068279
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCTGTGCATGGCGGGCTGCAAAACTTTGACCTGCAGCCCAAACTCAAG[C/T]AAGTGTTCGGAAAGGGTCTGATAAAAGCAGCAGTCACCACTGGGGCCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20961
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052584 Nonsense 279 1546 6 25
ENSDART00000086664 Nonsense 279 319 8 9
ENSDART00000140938 Nonsense 279 297 8 8
ENSDART00000147251   None 191 None 6
ENSDART00000147919 Nonsense 350 1306 7 24
Genomic Location (Zv9):
Chromosome 7 (position 30672950)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29065292
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCATACAGAAGACGTTCAACTATAACCGTAATCAAGCACAGCAGATTTA[T/A]CTCATGGTGATGGAGTGCATGAAGAAAAGAGAGCTGGTAAGTAAAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40909
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Missense, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052584 Splice Site None 1546 None 25
ENSDART00000086664 Missense 293 319 8 9
ENSDART00000140938 Missense 293 297 8 8
ENSDART00000147251   None 191 None 6
ENSDART00000147919 Splice Site None 1306 None 24
Genomic Location (Zv9):
Chromosome 7 (position 30672908)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29065250
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATTTATCTCATGGTGATGGAGTGCATGAAGAAAAGAGAGCTGGTAAG[T/A]AAAAAAAAAGAATAACACAATAGAAAAGATATGTTCCATATTTTTACCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15286
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052584 Nonsense 400 1546 9 25
ENSDART00000086664   None 319 None 9
ENSDART00000140938   None 297 None 8
ENSDART00000147251   None 191 None 6
ENSDART00000147919   None 1306 None 24
Genomic Location (Zv9):
Chromosome 7 (position 30669733)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29062075
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGCWAAGGTGCCAAATCAAAACCTGAGCCACCGGAGGAGACAGACCCT[A/T]GAAAACTAGAGCTGCTGAACTGGGTAAGATTTACTCWTTAATAGTTGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40908
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052584 Nonsense 829 1546 18 25
ENSDART00000086664   None 319 None 9
ENSDART00000140938   None 297 None 8
ENSDART00000147251   None 191 None 6
ENSDART00000147919 Nonsense 840 1306 18 24
Genomic Location (Zv9):
Chromosome 7 (position 30660328)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29052670
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCATTGCAGGAATGGATCGTCATTTCCTACATCATCACTCTTGGACTG[G/T]AGAAAGTTAGACAGGTGATGCATACAAGCAAAATAATATGTTGCTATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30632
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052584 Nonsense 1116 1546 24 25
ENSDART00000086664   None 319 None 9
ENSDART00000140938   None 297 None 8
ENSDART00000147251   None 191 None 6
ENSDART00000147919 Nonsense 1126 1306 23 24
Genomic Location (Zv9):
Chromosome 7 (position 30653959)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29046301
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGACTCTGAGTGCTGAGGAGCTGAAGAGTCTGTATGAGTTTGAGGAG[C/T]AGAATGTGGAGGAGTATTTCAGAGAGAAGGAGGATGAGGTGCAGTCTTCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link