trpm1

Ensembl ID:
ENSDARG00000011259
ZFIN ID:
ZDB-GENE-070112-1372
Description:
transient receptor potential cation channel, subfamily M, member 1 [Source:RefSeq peptide;Acc:NP_00
Human Orthologue:
TRPM1
Human Description:
transient receptor potential cation channel, subfamily M, member 1 [Source:HGNC Symbol;Acc:7146]
Mouse Orthologue:
Trpm1
Mouse Description:
transient receptor potential cation channel, subfamily M, member 1 Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10704 Essential Splice Site Available for shipment Available now
sa10436 Nonsense Available for shipment Available now
sa11580 Essential Splice Site Available for shipment Available now
sa20961 Nonsense Mutation detected in F1 DNA During 2014
sa8270 Nonsense Mutation detected in F1 DNA During 2014
sa15286 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10704
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052584 None None 1546 None 25
ENSDART00000086664 None None 319 None 9
ENSDART00000140938 None None 297 None 8
ENSDART00000147251 Essential Splice Site None 191 1 6
ENSDART00000147919 None None 1306 None 24
Genomic Location:
Chromosome 7 (position 30677786)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAGTCTGGCTTWATGTAAGCCTTTGGTCTTTCTCTTTAACTTCAAGGG[T/C]AAGTTCTAGAGTAGTATATNNGTACTACAACCTGTTTGCCTACCAGACTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10436
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052584 None None 1546 None 25
ENSDART00000086664 None None 319 2 9
ENSDART00000140938 None None 297 2 8
ENSDART00000147251 None None 191 2 6
ENSDART00000147919 Nonsense 26 1306 1 24
Genomic Location:
Chromosome 7 (position 30676864)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTTCTAAAAAGAGAGWGCAATCATATATTCCCCAGCAAAGAGCCCAAC[A/T]AGTCAGTAGCAATGTTTTTATTGTATTGYTCATACTCCTGGGGTATGAAY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11580
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052584 Essential Splice Site 22 1546 2 25
ENSDART00000086664 Essential Splice Site 22 319 4 9
ENSDART00000140938 Essential Splice Site 22 297 4 8
ENSDART00000147251 Essential Splice Site 22 191 4 6
ENSDART00000147919 Essential Splice Site 93 1306 3 24
Genomic Location:
Chromosome 7 (position 30676076)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAACATTTGATCAATTAAAATCTTCTCATYACTTTCTTSCTTGTTATTA[G/A]TATATCCGTGTGTCCTACGATACGAAACCGGATAACCTTCTGCATTTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20961
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052584 Nonsense 279 1546 6 25
ENSDART00000086664 Nonsense 279 319 8 9
ENSDART00000140938 Nonsense 279 297 8 8
ENSDART00000147251 None None 191 None 6
ENSDART00000147919 Nonsense 350 1306 7 24
Genomic Location:
Chromosome 7 (position 30672950)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCATACAGAAGACGTTCAACTATAACCGTAATCAAGCACAGCAGATTTA[T/A]CTCATGGTGATGGAGTGCATGAAGAAAAGAGAGCTGGTAAGTAAAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8270
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052584 Nonsense 385 1546 9 25
ENSDART00000086664 None None 319 None 9
ENSDART00000140938 None None 297 None 8
ENSDART00000147251 None None 191 None 6
ENSDART00000147919 None None 1306 None 24
Genomic Location:
Chromosome 7 (position 30669778)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATCGCCACCCGTGTCAGCAAAGGTAAACCTGCCAGGGGCAAGAAGGGC[A/T]AAGGTGCCAAATCAAAACCTGAGCCACCGGAGGAGACAGACCCTAGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15286
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052584 Nonsense 400 1546 9 25
ENSDART00000086664 None None 319 None 9
ENSDART00000140938 None None 297 None 8
ENSDART00000147251 None None 191 None 6
ENSDART00000147919 None None 1306 None 24
Genomic Location:
Chromosome 7 (position 30669733)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGCWAAGGTGCCAAATCAAAACCTGAGCCACCGGAGGAGACAGACCCT[A/T]GAAAACTAGAGCTGCTGAACTGGGTAAGATTTACTCWTTAATAGTTGTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v1zf60xw