enpp2

Ensembl ID:
ENSDARG00000011257
ZFIN ID:
ZDB-GENE-040426-1156
Description:
ectonucleotide pyrophosphatase/phosphodiesterase family member 2 [Source:RefSeq peptide;Acc:NP_9568
Human Orthologue:
ENPP2
Human Description:
ectonucleotide pyrophosphatase/phosphodiesterase 2 [Source:HGNC Symbol;Acc:3357]
Mouse Orthologue:
Enpp2
Mouse Description:
ectonucleotide pyrophosphatase/phosphodiesterase 2 Gene [Source:MGI Symbol;Acc:MGI:1321390]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6410 Essential Splice Site Mutation detected in F1 DNA During 2016
sa42664 Nonsense Mutation detected in F1 DNA During 2016
sa36049 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa6410
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047920 Essential Splice Site 41 850 3 25
ENSDART00000140527   None 406 None 13
Genomic Location:
Chromosome 16 (position 11081920)
KASP Assay ID:
554-4806.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAGACTMATGTTCTACATGTGTTTTTGTCTTTTCTTCATGTTCAWTCA[A/T]GGTTTCTCTGACCAGCCATTTACCAGCCTGGCAGGTTCTTGCAAAAAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42664
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047920 Nonsense 210 850 7 25
ENSDART00000140527   None 406 None 13
Genomic Location:
Chromosome 16 (position 11089610)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACCATACATGAGGCCTATGTATCCTACAAAAACCTACCCAAATTTGTA[T/A]ACAATTACAACGGTATGTATTAATTGCAGATTTTCAGAATCTGCAAGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36049
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047920 Nonsense 371 850 13 25
ENSDART00000140527 Nonsense 18 406 2 13
Genomic Location:
Chromosome 16 (position 11100562)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGGTATGGAGGAAGCTCATTGTGACAAAACAGAGTTCCTAAGTTCTTA[T/A]ATGTCCAACACTGAGGACCTCATCCTAATTCCTGGCTCTCTGGGAAGAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Identification, replication, and fine-mapping of Loci associated with adult height in individuals of african ancestry. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link