rnpc3

Ensembl ID:
ENSDARG00000011247
ZFIN ID:
ZDB-GENE-060312-35
Description:
RNA-binding protein 40 [Source:RefSeq peptide;Acc:NP_001035019]
Human Orthologue:
RNPC3
Human Description:
RNA-binding region (RNP1, RRM) containing 3 [Source:HGNC Symbol;Acc:18666]
Mouse Orthologue:
Rnpc3
Mouse Description:
RNA-binding region (RNP1, RRM) containing 3 Gene [Source:MGI Symbol;Acc:MGI:1914475]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37916 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37916
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017427 Nonsense 398 505 12 16
ENSDART00000122175 Nonsense 398 505 11 15
ENSDART00000132100 Nonsense 79 186 3 7
ENSDART00000136003   None 237 None 8
Genomic Location (Zv9):
Chromosome 24 (position 29883816)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 28882132
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTTTACATTTACAGAGATAAAGAAATTGTCTGTTTTTAAAAAGTA[C/A]GAACCCGGAGAACCAACCTGCAGGCTTTATGTTAAGAATGTTGCAAAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link