ift46

Ensembl ID:
ENSDARG00000011240
ZFIN ID:
ZDB-GENE-080102-3
Description:
Intraflagellar transport protein 46 homolog [Source:UniProtKB/Swiss-Prot;Acc:A7MBP4]
Human Orthologue:
IFT46
Human Description:
intraflagellar transport 46 homolog (Chlamydomonas) [Source:HGNC Symbol;Acc:26146]
Mouse Orthologue:
Ift46
Mouse Description:
intraflagellar transport 46 homolog (Chlamydomonas) Gene [Source:MGI Symbol;Acc:MGI:1923818]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34929 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34929
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088605 Essential Splice Site 293 372 9 12
Genomic Location (Zv9):
Chromosome 10 (position 30629768)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 29852172
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGCCTGATGCAAGAGTGGCCGTCTGAATTTGAGGAACTTCTGGGGAAG[G/A]TTGGTTCTCGAGTAATACGTTTTACTGGAAATACCCTTGTTATGCTATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link