otx2

Ensembl ID:
ENSDARG00000011235
ZFIN ID:
ZDB-GENE-980526-406
Description:
Homeobox protein OTX2 [Source:UniProtKB/Swiss-Prot;Acc:Q91981]
Human Orthologues:
OTX1, OTX2
Human Descriptions:
orthodenticle homeobox 1 [Source:HGNC Symbol;Acc:8521]
orthodenticle homeobox 2 [Source:HGNC Symbol;Acc:8522]
Mouse Orthologues:
Otx1, Otx2
Mouse Descriptions:
orthodenticle homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:97450]
orthodenticle homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:97451]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu3625 Essential Splice Site Available for shipment Available now
hu3237 Nonsense Confirmed mutation in F2 line Unknown

Mutation Details

Allele Name:
hu3625
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008816 Essential Splice Site 84 289 4 4
ENSDART00000126097 Essential Splice Site 84 289 3 3
Genomic Location:
Chromosome 17 (position 44292923)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGTTAGTTCACGTCGTAAATAATAAAAACCCCTTTTTTTCAACACATC[A/C]GGTTTGGTTCAAAAACCGAAGGGCAAAGTGTCGCCAACAGCAGCAACAAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
hu3237
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008816 Nonsense 87 289 4 4
ENSDART00000126097 Nonsense 87 289 3 3
Genomic Location:
Chromosome 17 (position 44292912)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTCGTAAATAATAAAAACCCCTTTTTTTCAACACATCAGGTTTGGTTC[A/T]AAAACCGAAGGGCAAAGTGTCGCCAACAGCAGCAACAACAACAAAACGGA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9pyp6z0g