otx2

Ensembl ID:
ENSDARG00000011235
ZFIN ID:
ZDB-GENE-980526-406
Description:
Homeobox protein OTX2 [Source:UniProtKB/Swiss-Prot;Acc:Q91981]
Human Orthologues:
OTX1, OTX2
Human Descriptions:
orthodenticle homeobox 1 [Source:HGNC Symbol;Acc:8521]
orthodenticle homeobox 2 [Source:HGNC Symbol;Acc:8522]
Mouse Orthologues:
Otx1, Otx2
Mouse Descriptions:
orthodenticle homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:97450]
orthodenticle homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:97451]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu3625 Essential Splice Site Available for shipment Available now
hu3237 Nonsense Confirmed mutation in F2 line Unknown
sa36505 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
hu3625
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008816 Essential Splice Site 84 289 4 4
ENSDART00000126097 Essential Splice Site 84 289 3 3
Genomic Location (Zv9):
Chromosome 17 (position 44292923)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 44132601
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGTTAGTTCACGTCGTAAATAATAAAAACCCCTTTTTTTCAACACATC[A/C]GGTTTGGTTCAAAAACCGAAGGGCAAAGTGTCGCCAACAGCAGCAACAAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
hu3237
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008816 Nonsense 87 289 4 4
ENSDART00000126097 Nonsense 87 289 3 3
Genomic Location (Zv9):
Chromosome 17 (position 44292912)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 44132590
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTCGTAAATAATAAAAACCCCTTTTTTTCAACACATCAGGTTTGGTTC[A/T]AAAACCGAAGGGCAAAGTGTCGCCAACAGCAGCAACAACAACAAAACGGA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa36505
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008816 Nonsense 100 289 4 4
ENSDART00000126097 Nonsense 100 289 3 3
Genomic Location (Zv9):
Chromosome 17 (position 44292873)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 44132551
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTTTGGTTCAAAAACCGAAGGGCAAAGTGTCGCCAACAGCAGCAACAA[C/T]AACAAAACGGAGGCCAGAACAAGGTGCGACCTGCCAAAAAGAAGAGCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link