akt2

Ensembl ID:
ENSDARG00000011219
ZFIN ID:
ZDB-GENE-031007-5
Description:
RAC-beta serine/threonine-protein kinase [Source:RefSeq peptide;Acc:NP_937789]
Human Orthologue:
AKT2
Human Description:
v-akt murine thymoma viral oncogene homolog 2 [Source:HGNC Symbol;Acc:392]
Mouse Orthologue:
Akt2
Mouse Description:
thymoma viral proto-oncogene 2 Gene [Source:MGI Symbol;Acc:MGI:104874]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7448 Missense Mutation detected in F1 DNA During 2014
sa23364 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7448
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026767 Missense 37 479 3 14
ENSDART00000130397 Missense 37 479 2 14
Genomic Location:
Chromosome 18 (position 39034589)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTTGGAGGCCTCGATATTTCATCCTAAAGAGTGATGGCTCTTTTATCG[G/A]CTACAAGGAGAAGCCGGAGACGTCAGAYGCCAATCAGCCACCTCTCAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23364
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026767 Nonsense 440 479 13 14
ENSDART00000130397 Nonsense 440 479 12 14
Genomic Location:
Chromosome 18 (position 39014360)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTCAAGCCGCAAGTGACCTCAGAGACAGACACACGCTACTTTGATGAT[G/T]AGTTCACTGCACAGACCATTACTGTCACTCCACCTGACCAATGTGAGTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/f2woa0mz