dnajc11

Ensembl ID:
ENSDARG00000011196
ZFIN ID:
ZDB-GENE-030131-1673
Description:
DnaJ (Hsp40) homolog, subfamily C, member 11 [Source:RefSeq peptide;Acc:NP_997796]
Human Orthologue:
DNAJC11
Human Description:
DnaJ (Hsp40) homolog, subfamily C, member 11 [Source:HGNC Symbol;Acc:25570]
Mouse Orthologue:
Dnajc11
Mouse Description:
DnaJ (Hsp40) homolog, subfamily C, member 11 Gene [Source:MGI Symbol;Acc:MGI:2443386]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16194 Nonsense Available for shipment Available now
sa9129 Nonsense Mutation detected in F1 DNA During 2017
sa24367 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16194
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016096 Nonsense 273 563 8 16
Genomic Location (Zv9):
Chromosome 23 (position 30954663)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 30789553
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCTCACTACTATGCTTGCACGTCACCTAGACAAAAACACTATGGGTTA[T/A]TTACAGTGGYGCTGGGGAACTCAGTCTTCCATGAACACCAGCATCGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9129
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016096 Nonsense 314 563 9 16
Genomic Location (Zv9):
Chromosome 23 (position 30954867)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 30789757
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTATCATTCTAGTTGGGAATTCCACATACATTTATCATGATGAGCTA[C/A]CAGTACAAATTCCAGGATGATGATCAGACCAAGATCAAGGGCTCTGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24367
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016096 Essential Splice Site 465 563 13 16
Genomic Location (Zv9):
Chromosome 23 (position 30959665)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 30794555
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCAGGAGTCTGTGCGCAGAATTATCGAAGCAGAGGAGTCTAAGATGGG[T/A]ATGACAGCATAACTCCCAATAATGATCAAAGGGTGCATTTTTATTTGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link