fgfr1b

Ensembl ID:
ENSDARG00000011190
ZFIN ID:
ZDB-GENE-060503-14
Description:
fibroblast growth factor receptor 1b [Source:RefSeq peptide;Acc:NP_001155204]
Human Orthologue:
FGFR1
Human Description:
fibroblast growth factor receptor 1 [Source:HGNC Symbol;Acc:3688]
Mouse Orthologue:
Fgfr1
Mouse Description:
fibroblast growth factor receptor 1 Gene [Source:MGI Symbol;Acc:MGI:95522]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14213 Nonsense Available for shipment Available now
sa13288 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14213
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067689 Nonsense 116 740 3 17
ENSDART00000075259 Nonsense 116 739 3 16
ENSDART00000075269 Nonsense 116 280 4 7
Genomic Location:
Chromosome 10 (position 43996687)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCCGAAGGAAACCCAATTCCCAAACTACGCTGGCTRAAGAATGGAAAA[G/T]AGTTCAAAAGAGACCAGCGCATCGGCGGCTACAAGGTATGATTATCAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13288
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067689 Nonsense 163 740 4 17
ENSDART00000075259 Nonsense 163 739 4 16
ENSDART00000075269 Nonsense 163 280 5 7
Genomic Location:
Chromosome 10 (position 44001292)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTACACGTGCCTTGTGGAGAACGAATACGGGAGCATCAACCACACCTA[T/G]CAGYTGGACGTAGTGGGTCAGTCACATATCCGTTTTAACCAATGGCATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wo58yslt