si:ch211-12m10.1

Ensembl ID:
ENSDARG00000011171
ZFIN ID:
ZDB-GENE-060503-100
Description:
Novel protein similar to vertebrate odz, odd Oz/ten-m homolog 2 (Drosophila) (ODZ2) [Source:UniProtK
Human Orthologue:
ODZ2
Human Description:
odz, odd Oz/ten-m homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:29943]
Mouse Orthologue:
Odz2
Mouse Description:
odd Oz/ten-m homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1345184]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12677 Nonsense Available for shipment Available now
sa14272 Nonsense Available for shipment Available now
sa15048 Nonsense Available for shipment Available now
sa13815 Nonsense Available for shipment Available now
sa37350 Nonsense Available for shipment Available now
sa9107 Nonsense Mutation detected in F1 DNA During 2017
sa10500 Nonsense Available for shipment Available now
sa23981 Nonsense Available for shipment Available now
sa23982 Nonsense Available for shipment Available now
sa43678 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa12677
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040740 Nonsense 179 1473 3 9
ENSDART00000135591 Nonsense 1221 2515 19 25
Genomic Location (Zv9):
Chromosome 21 (position 30757398)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31957322
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTYCCTGGCATTGATTACTCRCTCAGCAAACTTGCAATCCATTCTGCGT[T/A]GGAGAGCGCCACAGCTATCGCCATCTCCCACACAGGTGTGCTMTACATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14272
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040740 Nonsense 648 1473 7 9
ENSDART00000135591 Nonsense 1690 2515 23 25
Genomic Location (Zv9):
Chromosome 21 (position 30768490)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31968414
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTACTYGTTTTGTTTACGTNNNNNNTTTCTCTTNNNNNNNNNNTCTCYCTCTGCAGTCCATGGTGT[T/A]GCTGCTYCAGCAAAGTCAAAAGCARTACGTCTTTGATTTTGATACAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15048
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040740 Nonsense 890 1473 7 9
ENSDART00000135591 Nonsense 1932 2515 23 25
Genomic Location (Zv9):
Chromosome 21 (position 30769215)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31969139
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTTCGCTCATTGATGTATTGGAKGACAGTGCAGTATGACAGCATGGGA[A/T]GAGTTATCAAAYGTGAGTTAAAGATTGGTCCCTATGCCAATACYACACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13815
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040740 Nonsense 954 1473 7 9
ENSDART00000135591 Nonsense 1996 2515 23 25
Genomic Location (Zv9):
Chromosome 21 (position 30769409)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31969333
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTYCATTTGCTCAACCCGGGTAACAGTGCCCGTTTGCTGCCACTACGATA[T/A]GATCTTCGAGACCGAATTACGAGGTTGGGTGACATGCAGTAWCAACTCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37350
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040740 Nonsense 957 1473 7 9
ENSDART00000135591 Nonsense 1999 2515 23 25
Genomic Location (Zv9):
Chromosome 21 (position 30769416)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31969340
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTCAACCCGGGTAACAGTGCCCGTTTGCTGCCACTACGATATGATCTT[C/T]GAGACCGAATTACGAGGTTGGGTGACATGCAGTATCAACTCGATGAGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9107
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040740 Nonsense 968 1473 7 9
ENSDART00000135591 Nonsense 2010 2515 23 25
ENSDART00000040740 Nonsense 968 1473 7 9
ENSDART00000135591 Nonsense 2010 2515 23 25
Genomic Location (Zv9):
Chromosome 21 (position 30769451)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31969375
KASP Assay ID:
2261-5824.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACGATATGATCTTCGAGACCGAATTACGAGGTTGGGTGACATGCAGTA[T/A]CAACTCGATGARGACGGTGTGCTCATGCAGAGGGGCTCGGATGTATTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10500
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040740 Nonsense 968 1473 7 9
ENSDART00000135591 Nonsense 2010 2515 23 25
ENSDART00000040740 Nonsense 968 1473 7 9
ENSDART00000135591 Nonsense 2010 2515 23 25
Genomic Location (Zv9):
Chromosome 21 (position 30769451)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31969375
KASP Assay ID:
2261-5824.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACGATATGATCTTCGAGACCGAATTACGAGGTTGGGTGACATGCAGTA[T/A]CAACTCGATGARGACGGTGTGCTCATGCAGAGGGGCTCGGATGTATTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23981
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040740 Nonsense 1009 1473 7 9
ENSDART00000135591 Nonsense 2051 2515 23 25
Genomic Location (Zv9):
Chromosome 21 (position 30769574)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31969498
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCGAGCCTACAGCCGCACAGCAGGAGGTTGGAGTGTCCGTTACCGTTA[C/A]GATGGCCTTGGTCGCAGAGTCTCCCGCAGAACAAGTGAAGGCGAGCATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23982
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040740 Nonsense 1030 1473 7 9
ENSDART00000135591 Nonsense 2072 2515 23 25
Genomic Location (Zv9):
Chromosome 21 (position 30769637)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31969561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCAGAGTCTCCCGCAGAACAAGTGAAGGCGAGCATCAGCAGTACTTCTA[T/A]GCAGACTTGAACTATCCCACTCGGGTCACCCATGTGTACAACCACACGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43678
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040740 Nonsense 1134 1473 7 9
ENSDART00000135591 Nonsense 2176 2515 23 25
Genomic Location (Zv9):
Chromosome 21 (position 30769947)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 31969871
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTCCATGGAGGGCTTTATGATTCTCTCACAAAGCTGGTGCATTTTGCC[C/T]AGAGAGACTATGATGTCCTGGCAGGAAGATGGATTGCACCTGACCATACG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link