anxa1c

Ensembl ID:
ENSDARG00000011168
ZFIN ID:
ZDB-GENE-030131-5274
Description:
annexin A1c [Source:RefSeq peptide;Acc:NP_861425]
Human Orthologue:
ANXA1
Human Description:
annexin A1 [Source:HGNC Symbol;Acc:533]
Mouse Orthologue:
Anxa1
Mouse Description:
annexin A1 Gene [Source:MGI Symbol;Acc:MGI:96819]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1750 Essential Splice Site Available for shipment Available now
sa2262 Essential Splice Site Mutation detected in F1 DNA During 2014
sa25318 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18826 Nonsense Mutation detected in F1 DNA During 2014
sa12045 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1750
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006947 Essential Splice Site 124 341 5 12
ENSDART00000073931 None None 284 None 11
ENSDART00000135462 None None 246 None 10

The following transcripts of ENSDARG00000011168 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 67524423)
KASP Assay ID:
554-1743.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATAAAAACACCTAAATGTACTTACCTGCTTGCTTACTTAACTGATACTC[A/G]GGGTCTTGGGACAAGTGAGAATGTCCTGAGTGAAATTCTGGGGACAAGGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa2262
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006947 Essential Splice Site 154 341 6 12
ENSDART00000073931 None None 284 None 11
ENSDART00000135462 None None 246 None 10

The following transcripts of ENSDARG00000011168 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 67523995)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTATTGTGAATTATGCATTAAATAAAGTGTGACCCCTTTTCTGCTATGC[A/G]GTATATGGCGAGATGCTGGAGGAAGATATTAATAGTGATGTAAAAGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25318
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006947 Essential Splice Site 154 341 6 12
ENSDART00000073931 None None 284 None 11
ENSDART00000135462 None None 246 None 10

The following transcripts of ENSDARG00000011168 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 67523994)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATTGTGAATTATGCATTAAATAAAGTGTGACCCCTTTTCTGCTATGCA[G/A]TATATGGCGAGATGCTGGAGGAAGATATTAATAGTGATGTAAAAGGAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18826
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006947 Nonsense 245 341 9 12
ENSDART00000073931 Nonsense 188 284 8 11
ENSDART00000135462 Nonsense 150 246 7 10
ENSDART00000006947 Nonsense 245 341 9 12
ENSDART00000073931 Nonsense 188 284 8 11
ENSDART00000135462 Nonsense 150 246 7 10

The following transcripts of ENSDARG00000011168 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 67521077)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCCACAGTTTTCCAATATTATAGCCAATTAAGCAAAGATGGTTTGGCC[A/T]AAGATCTGGAGGGCGAGCTGAGTGGACACCTTGAAGACTGCCTGATGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12045
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006947 Nonsense 245 341 9 12
ENSDART00000073931 Nonsense 188 284 8 11
ENSDART00000135462 Nonsense 150 246 7 10
ENSDART00000006947 Nonsense 245 341 9 12
ENSDART00000073931 Nonsense 188 284 8 11
ENSDART00000135462 Nonsense 150 246 7 10

The following transcripts of ENSDARG00000011168 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 67521077)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCCACAGTTTTCCAATATTATAGCCAATTAAGCAAAGATGGTTTGGCC[A/T]AAGATCTGGAGGGCGAGCTGAGTGGACACCTTGAAGACTGCCTGATGACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/t3jsq3w9