cahz

Ensembl ID:
ENSDARG00000011166
ZFIN ID:
ZDB-GENE-980526-39
Description:
Carbonic anhydrase [Source:UniProtKB/Swiss-Prot;Acc:Q92051]
Human Orthologues:
CA1, CA13, CA2, CA3
Human Descriptions:
carbonic anhydrase I [Source:HGNC Symbol;Acc:1368]
carbonic anhydrase II [Source:HGNC Symbol;Acc:1373]
carbonic anhydrase III, muscle specific [Source:HGNC Symbol;Acc:1374]
carbonic anhydrase XIII [Source:HGNC Symbol;Acc:14914]
Mouse Orthologues:
Car1, Car13, Car2, Car3
Mouse Descriptions:
carbonic anhydrase 1 Gene [Source:MGI Symbol;Acc:MGI:88268]
carbonic anhydrase 13 Gene [Source:MGI Symbol;Acc:MGI:1931322]
carbonic anhydrase 2 Gene [Source:MGI Symbol;Acc:MGI:88269]
carbonic anhydrase 3 Gene [Source:MGI Symbol;Acc:MGI:88270]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32934 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32934
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013411 Nonsense 144 260 4 7

The following transcripts of ENSDARG00000011166 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 29196854)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 29498489
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCAAACTTTGGAGAAGCTGCCAGTAAGCCTGATGGCCTTGCTGTGGTT[G/T]GAGTTTTTCTCAAGGTCAGGATATTATTAAAAAAAAATTAAATAAAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link