arhgef18

Ensembl ID:
ENSDARG00000011157
ZFIN ID:
ZDB-GENE-040516-14
Description:
rho/rac guanine nucleotide exchange factor (GEF) 18 [Source:RefSeq peptide;Acc:NP_999983]
Human Orthologue:
ARHGEF18
Human Description:
Rho/Rac guanine nucleotide exchange factor (GEF) 18 [Source:HGNC Symbol;Acc:17090]
Mouse Orthologue:
Arhgef18
Mouse Description:
rho/rac guanine nucleotide exchange factor (GEF) 18 Gene [Source:MGI Symbol;Acc:MGI:2142567]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1637 Nonsense F2 line generated During 2014
sa16319 Essential Splice Site Available for shipment Available now
sa19819 Nonsense Mutation detected in F1 DNA During 2014
sa5157 Nonsense Mutation detected in F1 DNA During 2014
sa18733 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1637
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025841 Nonsense 41 940 5 21
ENSDART00000133951 Nonsense 41 68 4 4
ENSDART00000143496 Nonsense 41 73 6 6
Genomic Location:
Chromosome 2 (position 37247605)
KASP Assay ID:
554-1577.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTCGTCATCTACACAGAATGCCATTATAATGTGCTGCGTGACGATCTG[G/T]AGTCCGATGCTCGGGACTTTGAGGCTCCSACCWGGAGTTTAGCTGTTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16319
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025841 Essential Splice Site 77 940 5 21
ENSDART00000133951 None None 68 None 4
ENSDART00000143496 None None 73 None 6
Genomic Location:
Chromosome 2 (position 37247495)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAAAAACTTTTCCAAAGATGCCGWCAAAAGACAGGATGTAATACACGG[T/G]AAGGGACTGTGGTCTWTTTTTKTTNGTTTATTTGTTTATTTGTTTTWCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19819
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025841 Nonsense 110 940 6 21
ENSDART00000133951 None None 68 None 4
ENSDART00000143496 None None 73 None 6
Genomic Location:
Chromosome 2 (position 37247294)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAATGTGTACATTCGGGAGTTGCGTAACACCCTACAAATGGATGAGACA[C/T]GACTGGAAAGGCTGTTTCCACAGGTGGAAAACCTGCTGGAGGTGCACCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5157
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025841 Nonsense 437 940 12 21
ENSDART00000133951 None None 68 None 4
ENSDART00000143496 None None 73 None 6
ENSDART00000025841 Nonsense 437 940 12 21
ENSDART00000133951 None None 68 None 4
ENSDART00000143496 None None 73 None 6
Genomic Location:
Chromosome 2 (position 37235915)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGTAAAGGAAGAAGAGCCRGAAGAACTCYCTAAGAAGATCTRKGAATTT[C/T]AAAGTAATGTGCAGATTNACTCATTCRCAGTCTGGGATTTTAGTCTTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18733
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025841 Nonsense 437 940 12 21
ENSDART00000133951 None None 68 None 4
ENSDART00000143496 None None 73 None 6
ENSDART00000025841 Nonsense 437 940 12 21
ENSDART00000133951 None None 68 None 4
ENSDART00000143496 None None 73 None 6
Genomic Location:
Chromosome 2 (position 37235915)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTAAAGGAAGAAGAGCCAGAAGAACTCCCTAAGAAGATCTGGGAATTT[C/T]AAAGTAATGTGCAGATTTACTCATTCACAGTCTGGGATTTTAGTCTTCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wkddrob5