dpysl5a

Ensembl ID:
ENSDARG00000011141
ZFIN ID:
ZDB-GENE-030131-3136
Description:
dihydropyrimidinase-like 5 [Source:RefSeq peptide;Acc:NP_001018159]
Human Orthologue:
DPYSL5
Human Description:
dihydropyrimidinase-like 5 [Source:HGNC Symbol;Acc:20637]
Mouse Orthologue:
Dpysl5
Mouse Description:
dihydropyrimidinase-like 5 Gene [Source:MGI Symbol;Acc:MGI:1929772]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23135 Essential Splice Site Available for shipment Available now
sa10852 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23135
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010274 Essential Splice Site 363 564 9 13
ENSDART00000145236 Essential Splice Site 375 576 9 13
Genomic Location (Zv9):
Chromosome 17 (position 37077303)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 36962200
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTTCCTGGAGTTCAGGACCGTATGAGCGTCATGTGGGAACGAGGAGTGG[T/C]ATGTTTCATTTCATCACAGAATCCACACTGCTTGGTTTCTTTAGTGTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10852
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010274 Essential Splice Site 480 564 11 13
ENSDART00000145236 Essential Splice Site 492 576 11 13
Genomic Location (Zv9):
Chromosome 17 (position 37073392)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 36958289
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TYCGAACCTTYCCAGACTAYCTCTACAAGAAAATGGTSCAGAGGGAGAAG[G/T]TAACTYTACTCTACTTTTGCACATGTKTGGTTACAGTGAAGCGCAGGTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link