ccne

Ensembl ID:
ENSDARG00000011133
ZFIN ID:
ZDB-GENE-980526-168
Description:
G1/S-specific cyclin-E1 [Source:UniProtKB/Swiss-Prot;Acc:P47794]
Human Orthologue:
CCNE1
Human Description:
cyclin E1 [Source:HGNC Symbol;Acc:1589]
Mouse Orthologue:
Ccne1
Mouse Description:
cyclin E1 Gene [Source:MGI Symbol;Acc:MGI:88316]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17090 Nonsense Available for shipment Available now
sa25369 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8454 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17090
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007883 Nonsense 191 410 7 12
ENSDART00000133570 None None 156 None 6
ENSDART00000136158 None None 156 None 5

The following transcripts of ENSDARG00000011133 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 47635020)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTTGATCGSTTCATGGCCACACAAGAAAATGTCCTGAAAACAACGCTA[C/T]AGCTTATAGGCATCTCCTGTCTCTTTATAGCTGCCAAAATGGAAGTAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25369
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007883 Essential Splice Site 237 410 8 12
ENSDART00000133570 None None 156 None 6
ENSDART00000136158 None None 156 None 5

The following transcripts of ENSDARG00000011133 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 47635309)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCTGCACAGAGGATGACATTCTTAGCATGGAGATTATCATCATGAAGG[T/C]ATATTGTCTTTATATCAGTTAACCTCAGTACCATGCCTAAACCTGCAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8454
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007883 Nonsense 255 410 9 12
ENSDART00000133570 None None 156 None 6
ENSDART00000136158 None None 156 None 5

The following transcripts of ENSDARG00000011133 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 47635463)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAACTGGAGTTTGAGTCCTTTAACCCCGGTTGCTTGGCTCAACATCTA[T/A]ATGCAGATGGCCTATCTAAAGGAGACTGCTGAGGTTCTCACGGCCCAGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bladder cancer: A multi-stage genome-wide association study of bladder cancer identifies multiple susceptibility loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a3oo38uv