ahsa1l

Ensembl ID:
ENSDARG00000011127
ZFIN ID:
ZDB-GENE-030131-664
Description:
activator of 90 kDa heat shock protein ATPase homolog 1 [Source:RefSeq peptide;Acc:NP_997767]
Human Orthologue:
AHSA1
Human Description:
AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast) [Source:HGNC Symbol;Acc:1189]
Mouse Orthologue:
Ahsa1
Mouse Description:
AHA1, activator of heat shock protein ATPase homolog 1 (yeast) Gene [Source:MGI Symbol;Acc:MGI:23876

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8493 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8493
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029771 Essential Splice Site 119 338 None 9
ENSDART00000110527 Essential Splice Site 119 350 None 10

The following transcripts of ENSDARG00000011127 do not overlap with this mutation:

Genomic Location:
Chromosome 17 (position 43902817)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGCAATATCTGTTATKTAAGTGCTGATRATATTTTTGWTGACTCTCTT[A/G]GATCGGTGTCAGTCTTTGTAAAGATGARCCGGAAACAGCGCTGCTATCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ormg3a1k