pptc7

Ensembl ID:
ENSDARG00000011122
ZFIN ID:
ZDB-GENE-041114-74
Description:
Protein phosphatase PTC7 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q5U3N5]
Human Orthologue:
PPTC7
Human Description:
PTC7 protein phosphatase homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:30695]
Mouse Orthologue:
Pptc7
Mouse Description:
PTC7 protein phosphatase homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2444593]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7282 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7282
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015214 Essential Splice Site 279 297 5 6
Genomic Location (Zv9):
Chromosome 8 (position 4594453)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 4337484
KASP Assay ID:
554-4849.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTCTCCTTTTGCACAGTTTGCCTGCGATAATGGCTTGAATGTCAGAGG[T/G]GAGATATACTCCTTTTAAAACCTCTAAATTGTTATTTTATTAAAGGCCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link