ccna2

Ensembl ID:
ENSDARG00000011094
ZFIN ID:
ZDB-GENE-020418-1
Description:
cyclin-A2 [Source:RefSeq peptide;Acc:NP_694481]
Human Orthologue:
CCNA2
Human Description:
cyclin A2 [Source:HGNC Symbol;Acc:1578]
Mouse Orthologue:
Ccna2
Mouse Description:
cyclin A2 Gene [Source:MGI Symbol;Acc:MGI:108069]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14296 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14296
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031498 Nonsense 213 261 4 4
Genomic Location:
Chromosome 14 (position 49305531)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAAACAGCCAGAYATCACAAACAGCATGCGTGCTATTCTAGTRGACTG[G/A]TTGGTGGAAGTGGGAGAAGAATACAAGCTACAGAACGAGACTCTTTACCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fuo2hlhm