drd2b

Ensembl ID:
ENSDARG00000011091
ZFIN ID:
ZDB-GENE-030910-2
Description:
dopamine receptor D2b [Source:RefSeq peptide;Acc:NP_922918]
Human Orthologue:
DRD2
Human Description:
dopamine receptor D2 [Source:HGNC Symbol;Acc:3023]
Mouse Orthologue:
Drd2
Mouse Description:
dopamine receptor D2 Gene [Source:MGI Symbol;Acc:MGI:94924]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13467 Nonsense Available for shipment Available now
sa13379 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13467
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016418 Nonsense 158 452 3 7
ENSDART00000016418 Nonsense 158 452 3 7
Genomic Location (Zv9):
Chromosome 5 (position 59435318)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 57415990
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACACGCTACAGCTCCAAGAGACGGGTCACTGTAATGATCTCSGTTGTTT[G/A]GGTGCTTTCATTCGCCATTTCCTGCCCCCTGCTGTTTGGWTTAAATAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13379
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016418 Nonsense 158 452 3 7
ENSDART00000016418 Nonsense 158 452 3 7
Genomic Location (Zv9):
Chromosome 5 (position 59435318)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 57415990
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACACGCTACAGCTCCAAGAGACGGGTCACTGTAATGATCTCSGTTGTTT[G/A]GGTGCTTTCATTCGCCATTTCCTGCCCCCTGCTGTTTGGWTTAAATAACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link