LOC795679

Ensembl ID:
ENSDARG00000011083
Human Orthologues:
C3AR1, C5AR1
Human Descriptions:
complement component 3a receptor 1 [Source:HGNC Symbol;Acc:1319]
complement component 5a receptor 1 [Source:HGNC Symbol;Acc:1338]
Mouse Orthologues:
C3ar1, C5ar1, Gpr33
Mouse Descriptions:
complement component 3a receptor 1 Gene [Source:MGI Symbol;Acc:MGI:1097680]
complement component 5a receptor 1 Gene [Source:MGI Symbol;Acc:MGI:88232]
G protein-coupled receptor 33 Gene [Source:MGI Symbol;Acc:MGI:1277106]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42604 Nonsense Mutation detected in F1 DNA During 2017
sa35968 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42604
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059601 Nonsense 174 348 2 2
Genomic Location (Zv9):
Chromosome 15 (position 36495058)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 37895062
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCCATCTGCTGCAGCATACCGTTTGTCATCTGCCGTTCAGGAGAGAAT[A/T]AAACATGCAAATACAATCCTGGTACCAATATAAACTTTCTGTTCACATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35968
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059601 Nonsense 240 348 2 2
Genomic Location (Zv9):
Chromosome 15 (position 36494859)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 37894863
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAGCCTTTCCGTGTCATTTTATCAGTAATCCTGGCCTTTTTCATATGTT[G/A]GCTTCCCTTTCATCTTCAGCAGCTAATTACTGCAATGACAAAGGGGAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link