GLRA3

Ensembl ID:
ENSDARG00000011066
Description:
glycine receptor, alpha 3 [Source:HGNC Symbol;Acc:4328]
Human Orthologue:
GLRA3
Human Description:
glycine receptor, alpha 3 [Source:HGNC Symbol;Acc:4328]
Mouse Orthologue:
Glra3
Mouse Description:
glycine receptor, alpha 3 subunit Gene [Source:MGI Symbol;Acc:MGI:95749]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18125 Essential Splice Site Available for shipment Available now
sa32718 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa18125
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009777 Essential Splice Site 173 431 14 17
Genomic Location:
Chromosome 1 (position 38850945)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTACTACCAATACTGAAAAATCTAAATGTTTMTCTTGCTCTTTCATCTA[G/A]TTGGTTACACAATGAATGACCTGATCTTTGAGTGGCAAGAAAAGGGACCY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32718
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009777 Nonsense 293 431 16 17
Genomic Location:
Chromosome 1 (position 38836319)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATTAAAGGTTTCTGAGAAGGCATGTGTTTGTGTCCTGCAGGTGTCCTA[T/A]GTGAAGGCTATCGACATCTGGATGGCTGTGTGTTTGCTGTTTGTGTTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link